Incidental Mutation 'R6244:Fetub'
ID 505488
Institutional Source Beutler Lab
Gene Symbol Fetub
Ensembl Gene ENSMUSG00000022871
Gene Name fetuin beta
Synonyms 2310011O17Rik, D17980
MMRRC Submission 044435-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.060) question?
Stock # R6244 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 22737132-22758518 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 22751081 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 143 (R143C)
Ref Sequence ENSEMBL: ENSMUSP00000155898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023587] [ENSMUST00000116625] [ENSMUST00000167399] [ENSMUST00000170805] [ENSMUST00000231768] [ENSMUST00000231880] [ENSMUST00000232097]
AlphaFold Q9QXC1
Predicted Effect probably damaging
Transcript: ENSMUST00000023587
AA Change: R143C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023587
Gene: ENSMUSG00000022871
AA Change: R143C

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CY 28 129 1.05e-2 SMART
CY 153 255 1.77e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000116625
AA Change: R63C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112324
Gene: ENSMUSG00000022871
AA Change: R63C

DomainStartEndE-ValueType
Blast:CY 1 61 4e-33 BLAST
CY 73 175 1.77e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167399
AA Change: R143C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128745
Gene: ENSMUSG00000022871
AA Change: R143C

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CY 28 129 1.05e-2 SMART
CY 153 255 1.77e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000170805
AA Change: R143C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128989
Gene: ENSMUSG00000022871
AA Change: R143C

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CY 28 129 1.05e-2 SMART
CY 153 255 1.77e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000231768
AA Change: R143C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000231880
AA Change: R63C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000232097
AA Change: R143C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.2607 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 96% (82/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fetuin family, part of the cystatin superfamily of cysteine protease inhibitors. Fetuins have been implicated in several diverse functions, including osteogenesis and bone resorption, regulation of the insulin and hepatocyte growth factor receptors, and response to systemic inflammation. This protein may be secreted by cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit female infertility due to premature hardening of the zona pellucida. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430550D23Rik T C 2: 155,845,150 (GRCm39) H113R possibly damaging Het
Adgrf3 A T 5: 30,402,531 (GRCm39) M499K probably benign Het
Adgrv1 G A 13: 81,255,050 (GRCm39) T211I probably damaging Het
Adss2 C T 1: 177,604,395 (GRCm39) E153K probably benign Het
Ago4 C A 4: 126,405,280 (GRCm39) G431V possibly damaging Het
Araf G T X: 20,726,339 (GRCm39) R601L probably damaging Homo
Atp2b4 T A 1: 133,654,299 (GRCm39) I769F probably damaging Het
Atp9a T C 2: 168,531,272 (GRCm39) probably null Het
Bltp1 T C 3: 37,011,148 (GRCm39) V1782A probably benign Het
Brap C A 5: 121,803,372 (GRCm39) D173E probably benign Het
Brca2 G T 5: 150,490,443 (GRCm39) R3035L probably benign Het
Ccdc8 C A 7: 16,730,176 (GRCm39) P555Q probably benign Het
Ccser2 A G 14: 36,662,675 (GRCm39) S170P probably benign Het
Celsr2 T C 3: 108,300,444 (GRCm39) H860R probably damaging Het
Cenpc1 C A 5: 86,194,244 (GRCm39) R174M probably damaging Het
Cfap57 T G 4: 118,436,607 (GRCm39) I930L probably damaging Het
Cx3cr1 C T 9: 119,880,760 (GRCm39) R214H probably damaging Het
Cyp4f14 T A 17: 33,125,291 (GRCm39) H429L probably benign Het
D5Ertd579e A G 5: 36,772,620 (GRCm39) F592L probably damaging Het
Ddb1 A G 19: 10,603,287 (GRCm39) E865G probably damaging Het
Ddx50 A T 10: 62,457,345 (GRCm39) probably null Het
Dpp6 A G 5: 27,254,626 (GRCm39) T14A probably damaging Het
Echs1 C A 7: 139,692,982 (GRCm39) Q51H possibly damaging Het
Ecm2 A T 13: 49,683,783 (GRCm39) D587V probably damaging Het
Ect2l A T 10: 18,016,145 (GRCm39) Y666N possibly damaging Het
Epha2 G A 4: 141,044,223 (GRCm39) G342S probably benign Het
Fbxo33 C A 12: 59,252,865 (GRCm39) K211N probably benign Het
Fchsd2 A G 7: 100,908,983 (GRCm39) probably null Het
Fen1 A G 19: 10,178,051 (GRCm39) V131A probably damaging Het
Flnb A G 14: 7,892,092 (GRCm38) E587G probably damaging Het
Foxd3 A G 4: 99,545,477 (GRCm39) T206A possibly damaging Het
Fut1 A G 7: 45,268,730 (GRCm39) E228G possibly damaging Het
Galnt13 T C 2: 54,823,560 (GRCm39) F379L probably damaging Het
Gcnt2 A C 13: 41,014,717 (GRCm39) E296A probably damaging Het
Gm7145 T A 1: 117,913,870 (GRCm39) C251S probably damaging Het
Gpam G A 19: 55,059,417 (GRCm39) P810L probably damaging Het
Il1rl2 T A 1: 40,366,726 (GRCm39) L87M possibly damaging Het
Itgae A G 11: 73,036,427 (GRCm39) S1122G probably damaging Het
Kcnh7 T A 2: 63,012,570 (GRCm39) D46V probably damaging Het
Kcnn3 T G 3: 89,552,830 (GRCm39) Y511* probably null Het
Kdm3b T A 18: 34,926,058 (GRCm39) I66N probably damaging Het
Klk1b27 A T 7: 43,703,974 (GRCm39) H39L probably benign Het
Kmo C T 1: 175,487,261 (GRCm39) T404I possibly damaging Het
Krt222 C T 11: 99,125,884 (GRCm39) probably null Het
Magi3 G C 3: 103,923,013 (GRCm39) H1235D probably benign Het
Mapk8ip1 C A 2: 92,219,589 (GRCm39) G81C probably damaging Het
Med15 G A 16: 17,470,609 (GRCm39) Q583* probably null Het
Mroh2a T C 1: 88,184,476 (GRCm39) V1453A probably benign Het
Myh13 A G 11: 67,253,327 (GRCm39) M1488V probably benign Het
Naip2 A T 13: 100,288,645 (GRCm39) F1193L probably damaging Het
Nop58 T A 1: 59,742,014 (GRCm39) M181K probably damaging Het
Npepps A T 11: 97,104,616 (GRCm39) V796D probably damaging Het
Nr1d1 A G 11: 98,661,363 (GRCm39) F301S probably damaging Het
Nynrin G A 14: 56,105,485 (GRCm39) V832I probably damaging Het
Or13a28 C A 7: 140,218,346 (GRCm39) S244Y probably damaging Het
Or1j14 T A 2: 36,418,353 (GRCm39) C310S probably benign Het
Or2ak7 A T 11: 58,574,830 (GRCm39) T44S possibly damaging Het
Or4e1 T A 14: 52,701,352 (GRCm39) Y38F probably damaging Het
Or8k1 T A 2: 86,047,566 (GRCm39) T163S possibly damaging Het
Phrf1 T A 7: 140,817,586 (GRCm39) C132S probably damaging Het
Plekhn1 T C 4: 156,315,015 (GRCm39) probably null Het
Polr2a G A 11: 69,635,052 (GRCm39) T569M probably damaging Het
Prr29 A G 11: 106,267,458 (GRCm39) probably null Het
Rsf1 CG CGACGGCGGAG 7: 97,229,115 (GRCm39) probably benign Homo
Sc5d T C 9: 42,166,717 (GRCm39) E274G probably benign Het
Serpina1d A T 12: 103,731,087 (GRCm39) probably null Het
Serpinb11 T A 1: 107,299,972 (GRCm39) I106N probably damaging Het
Setd2 G A 9: 110,377,733 (GRCm39) R516K probably damaging Het
Sirt2 G T 7: 28,487,222 (GRCm39) C291F probably damaging Het
Stac3 T C 10: 127,344,044 (GRCm39) V314A probably damaging Het
Stat6 C T 10: 127,493,581 (GRCm39) probably null Het
Strn3 A G 12: 51,656,890 (GRCm39) V712A probably damaging Het
Tmc5 G T 7: 118,233,437 (GRCm39) G84C possibly damaging Het
Tnik C A 3: 28,704,328 (GRCm39) L996I probably damaging Het
Trim30d G T 7: 104,136,817 (GRCm39) T129K probably damaging Het
Triml1 G T 8: 43,591,793 (GRCm39) Y188* probably null Het
Trpc7 A G 13: 56,921,705 (GRCm39) Y760H probably damaging Het
Uaca G A 9: 60,777,326 (GRCm39) R571Q probably damaging Het
Ubash3a A T 17: 31,458,246 (GRCm39) Q575L possibly damaging Het
Usp49 T A 17: 47,983,827 (GRCm39) C61* probably null Het
Vmn2r18 A T 5: 151,508,116 (GRCm39) V336E probably damaging Het
Vwa8 T C 14: 79,324,102 (GRCm39) V1135A probably benign Het
Zcchc4 T C 5: 52,940,503 (GRCm39) V24A probably benign Het
Zfp354c A G 11: 50,705,798 (GRCm39) Y426H probably benign Het
Other mutations in Fetub
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00706:Fetub APN 16 22,754,446 (GRCm39) missense probably benign 0.29
IGL00843:Fetub APN 16 22,748,379 (GRCm39) splice site probably benign
IGL01450:Fetub APN 16 22,747,986 (GRCm39) missense probably benign 0.01
IGL01522:Fetub APN 16 22,748,391 (GRCm39) start codon destroyed probably null 0.10
IGL02222:Fetub APN 16 22,751,078 (GRCm39) missense probably damaging 1.00
IGL02745:Fetub APN 16 22,756,676 (GRCm39) missense probably damaging 0.99
R0062:Fetub UTSW 16 22,747,836 (GRCm39) intron probably benign
R0310:Fetub UTSW 16 22,748,506 (GRCm39) splice site probably benign
R0508:Fetub UTSW 16 22,748,045 (GRCm39) missense probably benign 0.01
R0604:Fetub UTSW 16 22,754,410 (GRCm39) missense possibly damaging 0.78
R1560:Fetub UTSW 16 22,758,117 (GRCm39) missense probably benign 0.00
R1844:Fetub UTSW 16 22,754,419 (GRCm39) missense possibly damaging 0.94
R1896:Fetub UTSW 16 22,751,045 (GRCm39) missense probably damaging 1.00
R3716:Fetub UTSW 16 22,754,443 (GRCm39) missense probably damaging 1.00
R3717:Fetub UTSW 16 22,754,443 (GRCm39) missense probably damaging 1.00
R4274:Fetub UTSW 16 22,754,429 (GRCm39) missense probably damaging 1.00
R4751:Fetub UTSW 16 22,756,645 (GRCm39) missense probably benign 0.02
R4941:Fetub UTSW 16 22,756,624 (GRCm39) missense probably benign 0.01
R5468:Fetub UTSW 16 22,751,081 (GRCm39) missense probably damaging 1.00
R5470:Fetub UTSW 16 22,751,081 (GRCm39) missense probably damaging 1.00
R5690:Fetub UTSW 16 22,751,081 (GRCm39) missense probably damaging 1.00
R5692:Fetub UTSW 16 22,751,081 (GRCm39) missense probably damaging 1.00
R5781:Fetub UTSW 16 22,751,081 (GRCm39) missense probably damaging 1.00
R6038:Fetub UTSW 16 22,751,081 (GRCm39) missense probably damaging 1.00
R6038:Fetub UTSW 16 22,751,081 (GRCm39) missense probably damaging 1.00
R6039:Fetub UTSW 16 22,751,081 (GRCm39) missense probably damaging 1.00
R6039:Fetub UTSW 16 22,751,081 (GRCm39) missense probably damaging 1.00
R6193:Fetub UTSW 16 22,751,081 (GRCm39) missense probably damaging 1.00
R6195:Fetub UTSW 16 22,751,081 (GRCm39) missense probably damaging 1.00
R6245:Fetub UTSW 16 22,751,081 (GRCm39) missense probably damaging 1.00
R6273:Fetub UTSW 16 22,751,081 (GRCm39) missense probably damaging 1.00
R6274:Fetub UTSW 16 22,751,081 (GRCm39) missense probably damaging 1.00
R7134:Fetub UTSW 16 22,748,007 (GRCm39) missense possibly damaging 0.54
R7698:Fetub UTSW 16 22,758,059 (GRCm39) missense probably benign 0.31
R7969:Fetub UTSW 16 22,748,449 (GRCm39) missense possibly damaging 0.89
R8437:Fetub UTSW 16 22,752,985 (GRCm39) missense possibly damaging 0.57
R8788:Fetub UTSW 16 22,758,182 (GRCm39) nonsense probably null
R8855:Fetub UTSW 16 22,758,321 (GRCm39) missense possibly damaging 0.61
R8866:Fetub UTSW 16 22,758,321 (GRCm39) missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- TGCTAAAGAGTTCTCCCCACC -3'
(R):5'- GTGACTTAGGAAGGCTGTCC -3'

Sequencing Primer
(F):5'- ACACAGAACTGGATTTAAGTTTCAC -3'
(R):5'- TTAGGAAGGCTGTCCCCTGG -3'
Posted On 2018-02-28