Mutagenetix > Incidental Mutations

Incidental Mutation 'R6245:Armc3'

505501

Institutional Source

Beutler Lab

Gene Symbol

Armc3

Ensembl Gene

ENSMUSG00000037683

Gene Name

armadillo repeat containing 3

Synonyms

4921513G22Rik

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_001081083.2, NM_001271563.1, NM_001271564.1, NM_001271565.1; MGI:1918132

Is this an essential gene?

Probably non essential (E-score: 0.086) question?

Stock #

R6245 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

19199302-19310241 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 19248705 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 219 (T219M)

Ref Sequence

ENSEMBL: ENSMUSP00000110287 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049255] [ENSMUST00000114640]

AlphaFold

A2AU72

Predicted Effect

probably damaging
Transcript: ENSMUST00000049255
AA Change: T219M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000048784
Gene: ENSMUSG00000037683
AA Change: T219M

Domain	Start	End	E-Value	Type
low complexity region	3	14	N/A	INTRINSIC
ARM	56	96	2.07e-2	SMART
ARM	97	138	9.84e1	SMART
ARM	139	179	7.86e-3	SMART
ARM	180	220	7.63e0	SMART
ARM	221	262	7.76e1	SMART
low complexity region	293	303	N/A	INTRINSIC
ARM	305	345	3.91e1	SMART
ARM	346	385	2.93e-2	SMART
ARM	387	427	7.74e-2	SMART
Blast:ARM	428	468	3e-11	BLAST
ARM	469	509	1.45e-1	SMART
low complexity region	544	557	N/A	INTRINSIC
low complexity region	583	595	N/A	INTRINSIC
low complexity region	620	639	N/A	INTRINSIC
low complexity region	675	696	N/A	INTRINSIC
Pfam:EDR1	723	857	3.1e-28	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000114640
AA Change: T219M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000110287
Gene: ENSMUSG00000037683
AA Change: T219M

Domain	Start	End	E-Value	Type
low complexity region	3	14	N/A	INTRINSIC
ARM	56	96	2.07e-2	SMART
ARM	97	138	9.84e1	SMART
ARM	139	179	7.86e-3	SMART
ARM	180	220	7.63e0	SMART
ARM	221	262	7.76e1	SMART
low complexity region	293	303	N/A	INTRINSIC
ARM	305	345	3.91e1	SMART
ARM	346	385	2.93e-2	SMART
ARM	387	427	7.74e-2	SMART
Blast:ARM	428	468	3e-11	BLAST
ARM	469	509	1.45e-1	SMART
Pfam:EDR1	549	868	1.4e-41	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Armadillo/beta-catenin (CTNNB1; MIM 116806)-like (ARM) domains are imperfect 45-amino acid repeats involved in protein-protein interactions. ARM domain-containing proteins, such as ARMC3, function in signal transduction, development, cell adhesion and mobility, and tumor initiation and metastasis (Li et al., 2006 [PubMed 16915934]).[supplied by OMIM, Mar 2008]

Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	C	15: 8,178,418	Y218H	probably benign	Het
Abca9	A	G	11: 110,135,423	I937T	probably damaging	Het
Adgrl3	T	A	5: 81,688,556	N720K	probably benign	Het
Akr1c21	T	G	13: 4,575,232	V54G	possibly damaging	Het
Alpi	G	T	1: 87,100,834	D111E	probably damaging	Het
Bms1	T	A	6: 118,396,836	E780V	probably damaging	Het
Ccdc159	T	C	9: 21,935,568	S244P	probably damaging	Het
Cdon	T	C	9: 35,476,939	W737R	probably damaging	Het
Chdh	T	A	14: 30,035,305	V395D	probably damaging	Het
Col22a1	C	A	15: 71,973,816	D366Y	probably damaging	Het
Crnkl1	T	A	2: 145,928,131	N264I	probably benign	Het
Ctnnd2	T	C	15: 30,905,748	L847P	probably damaging	Het
Cyp4a31	A	C	4: 115,571,348	T382P	possibly damaging	Het
Dcaf8	A	T	1: 172,165,867	M1L	probably benign	Het
Ddx31	T	A	2: 28,844,982	F52I	probably benign	Het
Eps15	G	A	4: 109,382,866	S852N	possibly damaging	Het
Fchsd1	A	T	18: 37,962,775	L552Q	probably damaging	Het
Fetub	C	T	16: 22,932,331	R143C	probably damaging	Het
Frem2	T	C	3: 53,655,824	M421V	probably benign	Het
Gm1110	T	G	9: 26,920,747	H36P	probably benign	Het
Gm11639	A	T	11: 104,785,008	Y1542F	probably benign	Het
Hadha	C	T	5: 30,120,044		probably null	Het
Hspa4	C	T	11: 53,262,939	E702K	probably benign	Het
Intu	C	A	3: 40,675,326	T362K	probably damaging	Het
Jaml	C	T	9: 45,097,919	T248I	probably damaging	Het
Kcnj1	A	T	9: 32,396,867	S176C	probably damaging	Het
Kcnj9	A	G	1: 172,326,137	L140P	probably damaging	Het
Kif7	T	C	7: 79,702,143	K957R	probably damaging	Het
Klc4	T	A	17: 46,636,679	I366F	probably damaging	Het
Lamb2	A	G	9: 108,488,199		probably null	Het
Madd	T	C	2: 91,178,104	D151G	probably benign	Het
Man2a1	C	A	17: 64,710,826	A689E	probably damaging	Het
Mapk8ip1	C	A	2: 92,389,244	G81C	probably damaging	Het
Msmp	T	C	4: 43,583,909	Y48C	probably damaging	Het
Muc6	T	C	7: 141,648,821	N567S	probably damaging	Het
Nrap	C	T	19: 56,379,875	A192T	possibly damaging	Het
Nrap	A	G	19: 56,354,221	Y748H	probably damaging	Het
Olfr1138	G	C	2: 87,737,896	Q143E	possibly damaging	Het
Olfr1370	T	A	13: 21,072,690	T204S	possibly damaging	Het
Olfr1384	T	A	11: 49,514,165	F176I	possibly damaging	Het
Pcdhb8	T	G	18: 37,357,169	D633E	possibly damaging	Het
Pcdhb9	G	A	18: 37,403,154	V734M	probably damaging	Het
Plscr1	T	C	9: 92,259,321	Y21H	unknown	Het
Ptk2b	G	T	14: 66,163,066	P767T	probably damaging	Het
Ptprz1	T	C	6: 23,051,990	Y1424H	probably damaging	Het
Sec31a	T	A	5: 100,386,184	Q118L	probably benign	Het
Selenop	A	G	15: 3,274,734	S21G	probably damaging	Het
Shank1	G	A	7: 44,352,253	S1132N	unknown	Het
Slf1	A	G	13: 77,084,383	L534P	probably damaging	Het
Sparcl1	T	A	5: 104,085,147	H596L	probably damaging	Het
Spocd1	C	T	4: 129,957,108		probably null	Het
Tbc1d24	A	T	17: 24,185,993	I59N	probably damaging	Het
Tctex1d1	A	G	4: 102,988,667	N32S	probably benign	Het
Tjp3	G	A	10: 81,277,276	T580I	probably benign	Het
Tmem154	C	T	3: 84,684,296	T51M	possibly damaging	Het
Tmem8b	G	A	4: 43,690,246	V894I	probably benign	Het
Trbv20	A	T	6: 41,188,906	L88F	possibly damaging	Het
Tssk2	A	C	16: 17,898,948	I72L	possibly damaging	Het
Tub	T	A	7: 109,027,058	I267N	probably damaging	Het
Vmn2r104	A	T	17: 20,041,567	F434I	possibly damaging	Het
Vmn2r42	T	C	7: 8,192,734	N471S	probably damaging	Het
Vmn2r94	C	G	17: 18,258,123	G121R	probably damaging	Het
Wdr72	T	C	9: 74,148,223	S245P	probably damaging	Het
Zbtb42	A	G	12: 112,679,535	Y48C	probably damaging	Het
Zdbf2	T	C	1: 63,304,433	V657A	possibly damaging	Het
Zfp768	A	T	7: 127,344,091	C288*	probably null	Het
Zfp988	T	A	4: 147,332,013	C301*	probably null	Het

Other mutations in Armc3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00535:Armc3	APN	2	19303858	missense	possibly damaging	0.48
IGL01123:Armc3	APN	2	19201805	missense	possibly damaging	0.87
IGL01142:Armc3	APN	2	19297898	splice site	probably benign
IGL01556:Armc3	APN	2	19269146	missense	probably damaging	1.00
IGL02145:Armc3	APN	2	19296860	missense	possibly damaging	0.81
IGL02145:Armc3	APN	2	19286137	critical splice donor site	probably null
IGL02152:Armc3	APN	2	19286137	critical splice donor site	probably null
IGL02154:Armc3	APN	2	19286137	critical splice donor site	probably null
IGL02243:Armc3	APN	2	19286137	critical splice donor site	probably null
IGL02244:Armc3	APN	2	19286137	critical splice donor site	probably null
IGL02516:Armc3	APN	2	19300506	missense	possibly damaging	0.94
IGL02691:Armc3	APN	2	19235484	missense	probably damaging	1.00
IGL03151:Armc3	APN	2	19238698	missense	probably damaging	1.00
IGL03190:Armc3	APN	2	19288950	missense	probably damaging	0.99
IGL03288:Armc3	APN	2	19235482	missense	probably damaging	1.00
IGL03338:Armc3	APN	2	19248701	missense	possibly damaging	0.88
R0015:Armc3	UTSW	2	19296321	critical splice acceptor site	probably null
R0015:Armc3	UTSW	2	19296321	critical splice acceptor site	probably null
R0256:Armc3	UTSW	2	19269216	missense	probably damaging	1.00
R0621:Armc3	UTSW	2	19295393	missense	probably damaging	0.96
R1326:Armc3	UTSW	2	19310124	makesense	probably null
R1470:Armc3	UTSW	2	19238736	missense	probably benign
R1470:Armc3	UTSW	2	19238736	missense	probably benign
R1489:Armc3	UTSW	2	19310047	missense	probably benign	0.01
R1990:Armc3	UTSW	2	19293142	missense	probably damaging	0.97
R1991:Armc3	UTSW	2	19293142	missense	probably damaging	0.97
R1992:Armc3	UTSW	2	19293142	missense	probably damaging	0.97
R2002:Armc3	UTSW	2	19288936	missense	probably benign	0.01
R2095:Armc3	UTSW	2	19288929	missense	possibly damaging	0.65
R2127:Armc3	UTSW	2	19201811	missense	probably damaging	1.00
R2158:Armc3	UTSW	2	19248633	missense	probably damaging	0.99
R2697:Armc3	UTSW	2	19303935	missense	probably damaging	1.00
R3809:Armc3	UTSW	2	19300665	missense	probably damaging	1.00
R3897:Armc3	UTSW	2	19269177	missense	probably damaging	1.00
R4107:Armc3	UTSW	2	19288909	missense	probably benign	0.13
R4326:Armc3	UTSW	2	19300473	missense	probably damaging	0.97
R4464:Armc3	UTSW	2	19248659	missense	probably damaging	0.99
R4702:Armc3	UTSW	2	19309981	missense	probably damaging	1.00
R4923:Armc3	UTSW	2	19292980	critical splice acceptor site	probably null
R5370:Armc3	UTSW	2	19286062	missense	probably benign	0.00
R5518:Armc3	UTSW	2	19297928	missense	probably benign	0.28
R5718:Armc3	UTSW	2	19303799	nonsense	probably null
R5739:Armc3	UTSW	2	19253917	missense	possibly damaging	0.67
R5913:Armc3	UTSW	2	19310047	missense	possibly damaging	0.65
R6211:Armc3	UTSW	2	19296803	critical splice acceptor site	probably null
R6841:Armc3	UTSW	2	19201819	splice site	probably null
R7003:Armc3	UTSW	2	19270028	missense	probably damaging	1.00
R7190:Armc3	UTSW	2	19293136	missense	probably damaging	1.00
R7499:Armc3	UTSW	2	19285979	missense	probably benign	0.03
R7738:Armc3	UTSW	2	19288950	missense	probably damaging	0.99
R7844:Armc3	UTSW	2	19254018	missense	possibly damaging	0.90
R7919:Armc3	UTSW	2	19286095	missense	probably benign	0.00
R8060:Armc3	UTSW	2	19288909	missense	probably benign	0.08
R8111:Armc3	UTSW	2	19296863	missense	probably benign
R8406:Armc3	UTSW	2	19235554	missense	probably damaging	0.98
R8485:Armc3	UTSW	2	19293134	missense	probably damaging	1.00
R8773:Armc3	UTSW	2	19288856	missense	probably benign	0.01
R8940:Armc3	UTSW	2	19235582	missense	probably damaging	1.00
Z1177:Armc3	UTSW	2	19285991	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ATAATAGATGCTCCCCATTCTGG -3'
(R):5'- GTTCTAGATGGTCTCTGTAACTAGGTC -3'

Sequencing Primer
(F):5'- CCCCATTCTGGAGATTGTGTTTTG -3'
(R):5'- AAATAGCCTAATAGACTTTACACAGC -3'

Posted On

2018-02-28