Incidental Mutation 'R6245:Olfr1138'
ID505503
Institutional Source Beutler Lab
Gene Symbol Olfr1138
Ensembl Gene ENSMUSG00000075149
Gene Nameolfactory receptor 1138
SynonymsGA_x6K02T2Q125-49242149-49241214, MOR177-8
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R6245 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location87736747-87739978 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 87737896 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Glutamic Acid at position 143 (Q143E)
Ref Sequence ENSEMBL: ENSMUSP00000148941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099848] [ENSMUST00000214573]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099848
AA Change: Q143E

PolyPhen 2 Score 0.540 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000097435
Gene: ENSMUSG00000075149
AA Change: Q143E

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.3e-45 PFAM
Pfam:7tm_1 41 290 1.5e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214573
AA Change: Q143E

PolyPhen 2 Score 0.540 (Sensitivity: 0.88; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,178,418 Y218H probably benign Het
Abca9 A G 11: 110,135,423 I937T probably damaging Het
Adgrl3 T A 5: 81,688,556 N720K probably benign Het
Akr1c21 T G 13: 4,575,232 V54G possibly damaging Het
Alpi G T 1: 87,100,834 D111E probably damaging Het
Armc3 C T 2: 19,248,705 T219M probably damaging Het
Bms1 T A 6: 118,396,836 E780V probably damaging Het
Ccdc159 T C 9: 21,935,568 S244P probably damaging Het
Cdon T C 9: 35,476,939 W737R probably damaging Het
Chdh T A 14: 30,035,305 V395D probably damaging Het
Col22a1 C A 15: 71,973,816 D366Y probably damaging Het
Crnkl1 T A 2: 145,928,131 N264I probably benign Het
Ctnnd2 T C 15: 30,905,748 L847P probably damaging Het
Cyp4a31 A C 4: 115,571,348 T382P possibly damaging Het
Dcaf8 A T 1: 172,165,867 M1L probably benign Het
Ddx31 T A 2: 28,844,982 F52I probably benign Het
Eps15 G A 4: 109,382,866 S852N possibly damaging Het
Fchsd1 A T 18: 37,962,775 L552Q probably damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Frem2 T C 3: 53,655,824 M421V probably benign Het
Gm1110 T G 9: 26,920,747 H36P probably benign Het
Gm11639 A T 11: 104,785,008 Y1542F probably benign Het
Hadha C T 5: 30,120,044 probably null Het
Hspa4 C T 11: 53,262,939 E702K probably benign Het
Intu C A 3: 40,675,326 T362K probably damaging Het
Jaml C T 9: 45,097,919 T248I probably damaging Het
Kcnj1 A T 9: 32,396,867 S176C probably damaging Het
Kcnj9 A G 1: 172,326,137 L140P probably damaging Het
Kif7 T C 7: 79,702,143 K957R probably damaging Het
Klc4 T A 17: 46,636,679 I366F probably damaging Het
Lamb2 A G 9: 108,488,199 probably null Het
Madd T C 2: 91,178,104 D151G probably benign Het
Man2a1 C A 17: 64,710,826 A689E probably damaging Het
Mapk8ip1 C A 2: 92,389,244 G81C probably damaging Het
Msmp T C 4: 43,583,909 Y48C probably damaging Het
Muc6 T C 7: 141,648,821 N567S probably damaging Het
Nrap A G 19: 56,354,221 Y748H probably damaging Het
Nrap C T 19: 56,379,875 A192T possibly damaging Het
Olfr1370 T A 13: 21,072,690 T204S possibly damaging Het
Olfr1384 T A 11: 49,514,165 F176I possibly damaging Het
Pcdhb8 T G 18: 37,357,169 D633E possibly damaging Het
Pcdhb9 G A 18: 37,403,154 V734M probably damaging Het
Plscr1 T C 9: 92,259,321 Y21H unknown Het
Ptk2b G T 14: 66,163,066 P767T probably damaging Het
Ptprz1 T C 6: 23,051,990 Y1424H probably damaging Het
Sec31a T A 5: 100,386,184 Q118L probably benign Het
Selenop A G 15: 3,274,734 S21G probably damaging Het
Shank1 G A 7: 44,352,253 S1132N unknown Het
Slf1 A G 13: 77,084,383 L534P probably damaging Het
Sparcl1 T A 5: 104,085,147 H596L probably damaging Het
Spocd1 C T 4: 129,957,108 probably null Het
Tbc1d24 A T 17: 24,185,993 I59N probably damaging Het
Tctex1d1 A G 4: 102,988,667 N32S probably benign Het
Tjp3 G A 10: 81,277,276 T580I probably benign Het
Tmem154 C T 3: 84,684,296 T51M possibly damaging Het
Tmem8b G A 4: 43,690,246 V894I probably benign Het
Trbv20 A T 6: 41,188,906 L88F possibly damaging Het
Tssk2 A C 16: 17,898,948 I72L possibly damaging Het
Tub T A 7: 109,027,058 I267N probably damaging Het
Vmn2r104 A T 17: 20,041,567 F434I possibly damaging Het
Vmn2r42 T C 7: 8,192,734 N471S probably damaging Het
Vmn2r94 C G 17: 18,258,123 G121R probably damaging Het
Wdr72 T C 9: 74,148,223 S245P probably damaging Het
Zbtb42 A G 12: 112,679,535 Y48C probably damaging Het
Zdbf2 T C 1: 63,304,433 V657A possibly damaging Het
Zfp768 A T 7: 127,344,091 C288* probably null Het
Zfp988 T A 4: 147,332,013 C301* probably null Het
Other mutations in Olfr1138
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02304:Olfr1138 APN 2 87737986 missense probably benign 0.01
IGL02490:Olfr1138 APN 2 87737955 missense probably damaging 1.00
IGL02730:Olfr1138 APN 2 87737641 missense probably damaging 1.00
IGL03106:Olfr1138 APN 2 87738118 missense probably benign 0.02
IGL03113:Olfr1138 APN 2 87738162 missense probably benign 0.01
R0450:Olfr1138 UTSW 2 87737481 missense probably damaging 0.98
R0469:Olfr1138 UTSW 2 87737481 missense probably damaging 0.98
R0510:Olfr1138 UTSW 2 87737481 missense probably damaging 0.98
R3696:Olfr1138 UTSW 2 87738016 missense probably benign
R3698:Olfr1138 UTSW 2 87738016 missense probably benign
R5149:Olfr1138 UTSW 2 87737405 missense probably benign
R5156:Olfr1138 UTSW 2 87737775 missense possibly damaging 0.95
R6701:Olfr1138 UTSW 2 87737409 missense probably benign
R7170:Olfr1138 UTSW 2 87737712 missense probably damaging 0.99
R7185:Olfr1138 UTSW 2 87738145 missense probably damaging 1.00
R7260:Olfr1138 UTSW 2 87738508 splice site probably null
R8065:Olfr1138 UTSW 2 87737803 missense probably damaging 1.00
R8067:Olfr1138 UTSW 2 87737803 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGCTCAGTTCAATGAAACC -3'
(R):5'- TGGTCCTAAGATGCTTGTAGACC -3'

Sequencing Primer
(F):5'- GTGCTCAGTTCAATGAAACCAAAAAC -3'
(R):5'- GTCCTAAGATGCTTGTAGACCTACTG -3'
Posted On2018-02-28