Mutagenetix > Incidental Mutation

Incidental Mutation 'R6245:Madd'

505504

Institutional Source

Beutler Lab

Gene Symbol

Madd

Ensembl Gene

ENSMUSG00000040687

Gene Name

MAP-kinase activating death domain

Synonyms

Rab3 GEP, 9630059K23Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6245 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

91137360-91183837 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 91178104 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 151 (D151G)

Ref Sequence

ENSEMBL: ENSMUSP00000107004 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066420] [ENSMUST00000066473] [ENSMUST00000075269] [ENSMUST00000077941] [ENSMUST00000099723] [ENSMUST00000099725] [ENSMUST00000111369] [ENSMUST00000111370] [ENSMUST00000111371] [ENSMUST00000111372] [ENSMUST00000111373] [ENSMUST00000111375] [ENSMUST00000111376] [ENSMUST00000111381] [ENSMUST00000140600]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000066420
AA Change: D151G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000067210
Gene: ENSMUSG00000040687
AA Change: D151G

Domain	Start	End	E-Value	Type
uDENN	7	97	7.11e-26	SMART
low complexity region	124	139	N/A	INTRINSIC
DENN	171	401	2.19e-67	SMART
low complexity region	412	428	N/A	INTRINSIC
dDENN	484	554	6.71e-13	SMART
low complexity region	619	639	N/A	INTRINSIC
low complexity region	699	718	N/A	INTRINSIC
low complexity region	781	789	N/A	INTRINSIC
low complexity region	816	839	N/A	INTRINSIC
low complexity region	908	918	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000066473
AA Change: D151G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000069350
Gene: ENSMUSG00000040687
AA Change: D151G

Domain	Start	End	E-Value	Type
uDENN	7	97	7.11e-26	SMART
low complexity region	124	139	N/A	INTRINSIC
DENN	171	401	2.19e-67	SMART
low complexity region	412	428	N/A	INTRINSIC
dDENN	484	554	6.71e-13	SMART
low complexity region	619	639	N/A	INTRINSIC
low complexity region	699	718	N/A	INTRINSIC
low complexity region	781	789	N/A	INTRINSIC
low complexity region	816	839	N/A	INTRINSIC
low complexity region	908	918	N/A	INTRINSIC
low complexity region	1334	1348	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000075269
AA Change: D151G

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000074746
Gene: ENSMUSG00000040687
AA Change: D151G

Domain	Start	End	E-Value	Type
uDENN	7	97	7.11e-26	SMART
low complexity region	124	139	N/A	INTRINSIC
DENN	171	401	2.19e-67	SMART
low complexity region	412	428	N/A	INTRINSIC
dDENN	484	554	6.71e-13	SMART
low complexity region	619	639	N/A	INTRINSIC
low complexity region	699	719	N/A	INTRINSIC
low complexity region	762	770	N/A	INTRINSIC
low complexity region	797	820	N/A	INTRINSIC
low complexity region	889	899	N/A	INTRINSIC
low complexity region	1276	1290	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000077941
AA Change: D151G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000077094
Gene: ENSMUSG00000040687
AA Change: D151G

Domain	Start	End	E-Value	Type
uDENN	7	97	7.11e-26	SMART
low complexity region	124	139	N/A	INTRINSIC
DENN	171	401	2.19e-67	SMART
low complexity region	412	428	N/A	INTRINSIC
dDENN	484	554	6.71e-13	SMART
low complexity region	619	639	N/A	INTRINSIC
low complexity region	699	718	N/A	INTRINSIC
low complexity region	781	789	N/A	INTRINSIC
low complexity region	816	839	N/A	INTRINSIC
low complexity region	928	938	N/A	INTRINSIC
low complexity region	1354	1368	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000099723
AA Change: D151G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000097311
Gene: ENSMUSG00000040687
AA Change: D151G

Domain	Start	End	E-Value	Type
uDENN	7	97	7.11e-26	SMART
low complexity region	124	139	N/A	INTRINSIC
DENN	171	401	2.19e-67	SMART
low complexity region	412	428	N/A	INTRINSIC
dDENN	484	554	6.71e-13	SMART
low complexity region	619	639	N/A	INTRINSIC
low complexity region	699	718	N/A	INTRINSIC
low complexity region	781	789	N/A	INTRINSIC
low complexity region	816	839	N/A	INTRINSIC
low complexity region	928	938	N/A	INTRINSIC
low complexity region	1189	1203	N/A	INTRINSIC
low complexity region	1353	1367	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000099725
AA Change: D151G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000097313
Gene: ENSMUSG00000040687
AA Change: D151G

Domain	Start	End	E-Value	Type
uDENN	7	97	7.11e-26	SMART
low complexity region	124	139	N/A	INTRINSIC
DENN	171	401	2.19e-67	SMART
low complexity region	412	428	N/A	INTRINSIC
dDENN	484	554	6.71e-13	SMART
low complexity region	619	639	N/A	INTRINSIC
low complexity region	699	718	N/A	INTRINSIC
low complexity region	781	789	N/A	INTRINSIC
low complexity region	816	839	N/A	INTRINSIC
low complexity region	908	918	N/A	INTRINSIC
low complexity region	1334	1348	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000111369
AA Change: D151G

PolyPhen 2 Score 0.262 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000107000
Gene: ENSMUSG00000040687
AA Change: D151G

Domain	Start	End	E-Value	Type
uDENN	7	97	7.11e-26	SMART
low complexity region	124	139	N/A	INTRINSIC
DENN	171	401	2.19e-67	SMART
low complexity region	412	428	N/A	INTRINSIC
dDENN	484	554	6.71e-13	SMART
low complexity region	619	639	N/A	INTRINSIC
low complexity region	699	721	N/A	INTRINSIC
low complexity region	773	796	N/A	INTRINSIC
low complexity region	865	875	N/A	INTRINSIC
low complexity region	1108	1122	N/A	INTRINSIC
low complexity region	1251	1265	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000111370
AA Change: D151G

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000107001
Gene: ENSMUSG00000040687
AA Change: D151G

Domain	Start	End	E-Value	Type
uDENN	7	97	7.11e-26	SMART
low complexity region	124	139	N/A	INTRINSIC
DENN	171	401	2.19e-67	SMART
low complexity region	412	428	N/A	INTRINSIC
dDENN	484	554	6.71e-13	SMART
low complexity region	619	639	N/A	INTRINSIC
low complexity region	699	718	N/A	INTRINSIC
low complexity region	781	789	N/A	INTRINSIC
low complexity region	816	839	N/A	INTRINSIC
low complexity region	908	918	N/A	INTRINSIC
low complexity region	1334	1348	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000111371
AA Change: D151G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000107002
Gene: ENSMUSG00000040687
AA Change: D151G

Domain	Start	End	E-Value	Type
uDENN	7	97	7.11e-26	SMART
low complexity region	124	139	N/A	INTRINSIC
DENN	171	401	2.19e-67	SMART
low complexity region	412	428	N/A	INTRINSIC
dDENN	484	554	6.71e-13	SMART
low complexity region	619	639	N/A	INTRINSIC
low complexity region	699	719	N/A	INTRINSIC
low complexity region	762	770	N/A	INTRINSIC
low complexity region	797	820	N/A	INTRINSIC
low complexity region	909	919	N/A	INTRINSIC
low complexity region	1296	1310	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000111372
AA Change: D151G

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000107003
Gene: ENSMUSG00000040687
AA Change: D151G

Domain	Start	End	E-Value	Type
uDENN	7	97	7.11e-26	SMART
low complexity region	124	139	N/A	INTRINSIC
DENN	171	401	2.19e-67	SMART
low complexity region	412	428	N/A	INTRINSIC
dDENN	484	554	6.71e-13	SMART
low complexity region	619	639	N/A	INTRINSIC
low complexity region	699	718	N/A	INTRINSIC
low complexity region	781	789	N/A	INTRINSIC
low complexity region	816	839	N/A	INTRINSIC
low complexity region	908	918	N/A	INTRINSIC
low complexity region	1295	1309	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000111373
AA Change: D151G

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000107004
Gene: ENSMUSG00000040687
AA Change: D151G

Domain	Start	End	E-Value	Type
uDENN	7	97	2.9e-29	SMART
low complexity region	124	139	N/A	INTRINSIC
DENN	171	401	8.7e-71	SMART
low complexity region	412	428	N/A	INTRINSIC
dDENN	484	554	2.8e-16	SMART
low complexity region	619	639	N/A	INTRINSIC
low complexity region	699	721	N/A	INTRINSIC
low complexity region	773	796	N/A	INTRINSIC
low complexity region	865	875	N/A	INTRINSIC
low complexity region	1108	1122	N/A	INTRINSIC
low complexity region	1251	1265	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000111375
AA Change: D151G

PolyPhen 2 Score 0.262 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000107006
Gene: ENSMUSG00000040687
AA Change: D151G

Domain	Start	End	E-Value	Type
uDENN	7	97	7.11e-26	SMART
low complexity region	124	139	N/A	INTRINSIC
DENN	171	401	2.19e-67	SMART
low complexity region	412	428	N/A	INTRINSIC
dDENN	484	554	6.71e-13	SMART
low complexity region	619	639	N/A	INTRINSIC
low complexity region	699	721	N/A	INTRINSIC
low complexity region	773	796	N/A	INTRINSIC
low complexity region	885	895	N/A	INTRINSIC
low complexity region	1272	1286	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000111376
AA Change: D151G

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000107007
Gene: ENSMUSG00000040687
AA Change: D151G

Domain	Start	End	E-Value	Type
uDENN	7	97	7.11e-26	SMART
low complexity region	124	139	N/A	INTRINSIC
DENN	171	401	2.19e-67	SMART
low complexity region	412	428	N/A	INTRINSIC
dDENN	484	554	6.71e-13	SMART
low complexity region	619	639	N/A	INTRINSIC
low complexity region	699	721	N/A	INTRINSIC
low complexity region	781	789	N/A	INTRINSIC
low complexity region	816	839	N/A	INTRINSIC
low complexity region	908	918	N/A	INTRINSIC
low complexity region	1151	1162	N/A	INTRINSIC
low complexity region	1312	1326	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000111381
AA Change: D151G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000107012
Gene: ENSMUSG00000040687
AA Change: D151G

Domain	Start	End	E-Value	Type
uDENN	7	97	7.11e-26	SMART
low complexity region	124	139	N/A	INTRINSIC
DENN	171	401	2.19e-67	SMART
low complexity region	412	428	N/A	INTRINSIC
dDENN	484	554	6.71e-13	SMART
low complexity region	619	639	N/A	INTRINSIC
low complexity region	699	718	N/A	INTRINSIC
low complexity region	781	789	N/A	INTRINSIC
low complexity region	816	839	N/A	INTRINSIC
low complexity region	928	938	N/A	INTRINSIC
low complexity region	1315	1329	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153688

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135715

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154028

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150461

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130395

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150517

Predicted Effect

probably benign
Transcript: ENSMUST00000140600

SMART Domains

Protein: ENSMUSP00000117657
Gene: ENSMUSG00000040687

Domain	Start	End	E-Value	Type
Blast:DENN	1	28	7e-10	BLAST
low complexity region	39	55	N/A	INTRINSIC
dDENN	111	165	9.37e-1	SMART
low complexity region	230	250	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125321

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125227

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Tumor necrosis factor alpha (TNF-alpha) is a signaling molecule that interacts with one of two receptors on cells targeted for apoptosis. The apoptotic signal is transduced inside these cells by cytoplasmic adaptor proteins. The protein encoded by this gene is a death domain-containing adaptor protein that interacts with the death domain of TNF-alpha receptor 1 to activate mitogen-activated protein kinase (MAPK) and propagate the apoptotic signal. It is membrane-bound and expressed at a higher level in neoplastic cells than in normal cells. Several transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele die shortly after birth due to respiratory failure, are hyporesponsive to tactile stimuli, and exhibit defects in neurotransmitter release with impaired synaptic vesicle trafficking and depletion of synaptic vesicles at the neuromuscular junction. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	C	15: 8,178,418	Y218H	probably benign	Het
Abca9	A	G	11: 110,135,423	I937T	probably damaging	Het
Adgrl3	T	A	5: 81,688,556	N720K	probably benign	Het
Akr1c21	T	G	13: 4,575,232	V54G	possibly damaging	Het
Alpi	G	T	1: 87,100,834	D111E	probably damaging	Het
Armc3	C	T	2: 19,248,705	T219M	probably damaging	Het
Bms1	T	A	6: 118,396,836	E780V	probably damaging	Het
Ccdc159	T	C	9: 21,935,568	S244P	probably damaging	Het
Cdon	T	C	9: 35,476,939	W737R	probably damaging	Het
Chdh	T	A	14: 30,035,305	V395D	probably damaging	Het
Col22a1	C	A	15: 71,973,816	D366Y	probably damaging	Het
Crnkl1	T	A	2: 145,928,131	N264I	probably benign	Het
Ctnnd2	T	C	15: 30,905,748	L847P	probably damaging	Het
Cyp4a31	A	C	4: 115,571,348	T382P	possibly damaging	Het
Dcaf8	A	T	1: 172,165,867	M1L	probably benign	Het
Ddx31	T	A	2: 28,844,982	F52I	probably benign	Het
Eps15	G	A	4: 109,382,866	S852N	possibly damaging	Het
Fchsd1	A	T	18: 37,962,775	L552Q	probably damaging	Het
Fetub	C	T	16: 22,932,331	R143C	probably damaging	Het
Frem2	T	C	3: 53,655,824	M421V	probably benign	Het
Gm1110	T	G	9: 26,920,747	H36P	probably benign	Het
Gm11639	A	T	11: 104,785,008	Y1542F	probably benign	Het
Hadha	C	T	5: 30,120,044		probably null	Het
Hspa4	C	T	11: 53,262,939	E702K	probably benign	Het
Intu	C	A	3: 40,675,326	T362K	probably damaging	Het
Jaml	C	T	9: 45,097,919	T248I	probably damaging	Het
Kcnj1	A	T	9: 32,396,867	S176C	probably damaging	Het
Kcnj9	A	G	1: 172,326,137	L140P	probably damaging	Het
Kif7	T	C	7: 79,702,143	K957R	probably damaging	Het
Klc4	T	A	17: 46,636,679	I366F	probably damaging	Het
Lamb2	A	G	9: 108,488,199		probably null	Het
Man2a1	C	A	17: 64,710,826	A689E	probably damaging	Het
Mapk8ip1	C	A	2: 92,389,244	G81C	probably damaging	Het
Msmp	T	C	4: 43,583,909	Y48C	probably damaging	Het
Muc6	T	C	7: 141,648,821	N567S	probably damaging	Het
Nrap	A	G	19: 56,354,221	Y748H	probably damaging	Het
Nrap	C	T	19: 56,379,875	A192T	possibly damaging	Het
Olfr1138	G	C	2: 87,737,896	Q143E	possibly damaging	Het
Olfr1370	T	A	13: 21,072,690	T204S	possibly damaging	Het
Olfr1384	T	A	11: 49,514,165	F176I	possibly damaging	Het
Pcdhb8	T	G	18: 37,357,169	D633E	possibly damaging	Het
Pcdhb9	G	A	18: 37,403,154	V734M	probably damaging	Het
Plscr1	T	C	9: 92,259,321	Y21H	unknown	Het
Ptk2b	G	T	14: 66,163,066	P767T	probably damaging	Het
Ptprz1	T	C	6: 23,051,990	Y1424H	probably damaging	Het
Sec31a	T	A	5: 100,386,184	Q118L	probably benign	Het
Selenop	A	G	15: 3,274,734	S21G	probably damaging	Het
Shank1	G	A	7: 44,352,253	S1132N	unknown	Het
Slf1	A	G	13: 77,084,383	L534P	probably damaging	Het
Sparcl1	T	A	5: 104,085,147	H596L	probably damaging	Het
Spocd1	C	T	4: 129,957,108		probably null	Het
Tbc1d24	A	T	17: 24,185,993	I59N	probably damaging	Het
Tctex1d1	A	G	4: 102,988,667	N32S	probably benign	Het
Tjp3	G	A	10: 81,277,276	T580I	probably benign	Het
Tmem154	C	T	3: 84,684,296	T51M	possibly damaging	Het
Tmem8b	G	A	4: 43,690,246	V894I	probably benign	Het
Trbv20	A	T	6: 41,188,906	L88F	possibly damaging	Het
Tssk2	A	C	16: 17,898,948	I72L	possibly damaging	Het
Tub	T	A	7: 109,027,058	I267N	probably damaging	Het
Vmn2r104	A	T	17: 20,041,567	F434I	possibly damaging	Het
Vmn2r42	T	C	7: 8,192,734	N471S	probably damaging	Het
Vmn2r94	C	G	17: 18,258,123	G121R	probably damaging	Het
Wdr72	T	C	9: 74,148,223	S245P	probably damaging	Het
Zbtb42	A	G	12: 112,679,535	Y48C	probably damaging	Het
Zdbf2	T	C	1: 63,304,433	V657A	possibly damaging	Het
Zfp768	A	T	7: 127,344,091	C288*	probably null	Het
Zfp988	T	A	4: 147,332,013	C301*	probably null	Het

Other mutations in Madd

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Madd	APN	2	91175766	unclassified	probably benign
IGL00781:Madd	APN	2	91146928	missense	probably benign	0.00
IGL00844:Madd	APN	2	91167868	missense	probably damaging	1.00
IGL00942:Madd	APN	2	91170578	missense	probably damaging	1.00
IGL01100:Madd	APN	2	91158040	missense	probably damaging	1.00
IGL01116:Madd	APN	2	91154543	splice site	probably benign
IGL01694:Madd	APN	2	91157975	splice site	probably benign
IGL01982:Madd	APN	2	91175707	missense	probably damaging	1.00
IGL02346:Madd	APN	2	91162491	missense	probably damaging	0.97
IGL02354:Madd	APN	2	91162198	missense	probably benign	0.17
IGL02361:Madd	APN	2	91162198	missense	probably benign	0.17
IGL02481:Madd	APN	2	91178036	missense	probably damaging	1.00
IGL02483:Madd	APN	2	91178036	missense	probably damaging	1.00
IGL02948:Madd	APN	2	91142827	missense	probably benign
IGL03338:Madd	APN	2	91162162	missense	possibly damaging	0.48
BB005:Madd	UTSW	2	91176888	missense	probably damaging	1.00
BB015:Madd	UTSW	2	91176888	missense	probably damaging	1.00
R0026:Madd	UTSW	2	91175708	missense	possibly damaging	0.88
R0026:Madd	UTSW	2	91175708	missense	possibly damaging	0.88
R0027:Madd	UTSW	2	91152549	missense	probably damaging	0.97
R0085:Madd	UTSW	2	91162738	missense	probably benign	0.00
R0577:Madd	UTSW	2	91138395	missense	possibly damaging	0.88
R0587:Madd	UTSW	2	91146885	missense	probably damaging	1.00
R1112:Madd	UTSW	2	91143599	missense	probably damaging	1.00
R1722:Madd	UTSW	2	91167637	missense	probably benign
R1750:Madd	UTSW	2	91167891	missense	probably damaging	0.98
R2061:Madd	UTSW	2	91161486	intron	probably benign
R2112:Madd	UTSW	2	91176976	missense	possibly damaging	0.89
R2114:Madd	UTSW	2	91164022	missense	probably damaging	1.00
R2140:Madd	UTSW	2	91152509	missense	possibly damaging	0.80
R2276:Madd	UTSW	2	91143683	missense	possibly damaging	0.67
R2277:Madd	UTSW	2	91143683	missense	possibly damaging	0.67
R2279:Madd	UTSW	2	91143683	missense	possibly damaging	0.67
R2424:Madd	UTSW	2	91166622	missense	probably damaging	1.00
R2904:Madd	UTSW	2	91175672	missense	probably damaging	1.00
R3122:Madd	UTSW	2	91176209	missense	probably damaging	1.00
R3836:Madd	UTSW	2	91154643	critical splice donor site	probably null
R3979:Madd	UTSW	2	91176828	missense	possibly damaging	0.81
R4151:Madd	UTSW	2	91143083	missense	probably benign	0.11
R4233:Madd	UTSW	2	91178236	missense	probably benign	0.26
R4236:Madd	UTSW	2	91167028	missense	probably benign	0.00
R4299:Madd	UTSW	2	91169803	missense	probably damaging	1.00
R4334:Madd	UTSW	2	91140572	missense	probably benign	0.08
R4413:Madd	UTSW	2	91167587	missense	probably damaging	1.00
R4595:Madd	UTSW	2	91167664	missense	possibly damaging	0.80
R4694:Madd	UTSW	2	91160328	missense	probably damaging	0.99
R5410:Madd	UTSW	2	91154514	missense	probably damaging	1.00
R5490:Madd	UTSW	2	91170635	missense	possibly damaging	0.80
R5560:Madd	UTSW	2	91163545	missense	probably damaging	1.00
R5661:Madd	UTSW	2	91154433	critical splice donor site	probably null
R5710:Madd	UTSW	2	91154476	missense	probably damaging	1.00
R5730:Madd	UTSW	2	91158109	missense	probably damaging	1.00
R5759:Madd	UTSW	2	91162075	missense	possibly damaging	0.94
R5768:Madd	UTSW	2	91167829	missense	probably damaging	1.00
R5822:Madd	UTSW	2	91152533	missense	probably damaging	1.00
R6125:Madd	UTSW	2	91152452	critical splice donor site	probably null
R6151:Madd	UTSW	2	91165457	nonsense	probably null
R6229:Madd	UTSW	2	91143670	missense	probably damaging	0.96
R6230:Madd	UTSW	2	91143521	critical splice donor site	probably null
R6323:Madd	UTSW	2	91161438	splice site	probably null
R6456:Madd	UTSW	2	91178191	missense	probably benign
R6473:Madd	UTSW	2	91167059	missense	probably benign
R6878:Madd	UTSW	2	91169857	missense	probably damaging	1.00
R7060:Madd	UTSW	2	91177107	missense	probably damaging	1.00
R7065:Madd	UTSW	2	91155057	missense	probably benign	0.26
R7073:Madd	UTSW	2	91162509	missense	probably damaging	1.00
R7124:Madd	UTSW	2	91162048	missense	possibly damaging	0.94
R7251:Madd	UTSW	2	91162176	missense	probably benign	0.01
R7510:Madd	UTSW	2	91177976	missense	possibly damaging	0.80
R7605:Madd	UTSW	2	91169710	missense	possibly damaging	0.90
R7911:Madd	UTSW	2	91167508	missense	probably null	0.01
R7928:Madd	UTSW	2	91176888	missense	probably damaging	1.00
R7952:Madd	UTSW	2	91162541	missense	probably damaging	1.00
R8039:Madd	UTSW	2	91167061	missense	probably benign	0.17
R8047:Madd	UTSW	2	91179201	missense	probably damaging	1.00
R8048:Madd	UTSW	2	91154448	missense	probably damaging	0.99
R8070:Madd	UTSW	2	91158014	nonsense	probably null
R8090:Madd	UTSW	2	91155623	missense	probably benign	0.01
R8335:Madd	UTSW	2	91170239	missense	probably damaging	1.00
R8459:Madd	UTSW	2	91162526	missense	probably benign
R8678:Madd	UTSW	2	91176265	missense	probably damaging	1.00
R8920:Madd	UTSW	2	91176823	missense	probably benign	0.04
R9003:Madd	UTSW	2	91158014	nonsense	probably null
R9102:Madd	UTSW	2	91158059	missense	probably benign	0.00
R9154:Madd	UTSW	2	91167817	missense	probably damaging	1.00
R9242:Madd	UTSW	2	91143604	missense	probably damaging	0.99
R9277:Madd	UTSW	2	91175710	missense	probably damaging	1.00
R9394:Madd	UTSW	2	91169854	missense	probably benign
R9490:Madd	UTSW	2	91178156	missense	probably benign
R9499:Madd	UTSW	2	91170089	missense	probably damaging	1.00
R9551:Madd	UTSW	2	91170089	missense	probably damaging	1.00
R9553:Madd	UTSW	2	91178455	missense	probably damaging	1.00
R9599:Madd	UTSW	2	91175681	missense	probably damaging	1.00
R9695:Madd	UTSW	2	91162584	missense	probably benign	0.17
R9729:Madd	UTSW	2	91170199	missense	possibly damaging	0.60
X0067:Madd	UTSW	2	91152473	missense	probably damaging	1.00
Z1176:Madd	UTSW	2	91159272	missense	probably damaging	0.96
Z1177:Madd	UTSW	2	91142831	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GATGCCCAGTTTCTTGCCTAG -3'
(R):5'- CTAACCGATAAGGACACCGGAG -3'

Sequencing Primer
(F):5'- TAGCAGCCGTTCACTACAGCAG -3'
(R):5'- CGCTATGGCATCTGTGTCAAC -3'

Posted On

2018-02-28