Incidental Mutation 'R6245:Cyp4a31'
ID505514
Institutional Source Beutler Lab
Gene Symbol Cyp4a31
Ensembl Gene ENSMUSG00000028712
Gene Namecytochrome P450, family 4, subfamily a, polypeptide 31
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R6245 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location115563649-115579015 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 115571348 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 382 (T382P)
Ref Sequence ENSEMBL: ENSMUSP00000030480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030480] [ENSMUST00000030486] [ENSMUST00000126645] [ENSMUST00000141033]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030480
AA Change: T382P

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000030480
Gene: ENSMUSG00000028712
AA Change: T382P

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:p450 51 415 3.6e-97 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000030486
AA Change: T397P

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000030486
Gene: ENSMUSG00000028712
AA Change: T397P

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:p450 51 504 2.6e-134 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126645
SMART Domains Protein: ENSMUSP00000117129
Gene: ENSMUSG00000028712

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:p450 51 340 4.3e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141033
SMART Domains Protein: ENSMUSP00000115628
Gene: ENSMUSG00000028712

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:p450 51 155 2.9e-17 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,178,418 Y218H probably benign Het
Abca9 A G 11: 110,135,423 I937T probably damaging Het
Adgrl3 T A 5: 81,688,556 N720K probably benign Het
Akr1c21 T G 13: 4,575,232 V54G possibly damaging Het
Alpi G T 1: 87,100,834 D111E probably damaging Het
Armc3 C T 2: 19,248,705 T219M probably damaging Het
Bms1 T A 6: 118,396,836 E780V probably damaging Het
Ccdc159 T C 9: 21,935,568 S244P probably damaging Het
Cdon T C 9: 35,476,939 W737R probably damaging Het
Chdh T A 14: 30,035,305 V395D probably damaging Het
Col22a1 C A 15: 71,973,816 D366Y probably damaging Het
Crnkl1 T A 2: 145,928,131 N264I probably benign Het
Ctnnd2 T C 15: 30,905,748 L847P probably damaging Het
Dcaf8 A T 1: 172,165,867 M1L probably benign Het
Ddx31 T A 2: 28,844,982 F52I probably benign Het
Eps15 G A 4: 109,382,866 S852N possibly damaging Het
Fchsd1 A T 18: 37,962,775 L552Q probably damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Frem2 T C 3: 53,655,824 M421V probably benign Het
Gm1110 T G 9: 26,920,747 H36P probably benign Het
Gm11639 A T 11: 104,785,008 Y1542F probably benign Het
Hadha C T 5: 30,120,044 probably null Het
Hspa4 C T 11: 53,262,939 E702K probably benign Het
Intu C A 3: 40,675,326 T362K probably damaging Het
Jaml C T 9: 45,097,919 T248I probably damaging Het
Kcnj1 A T 9: 32,396,867 S176C probably damaging Het
Kcnj9 A G 1: 172,326,137 L140P probably damaging Het
Kif7 T C 7: 79,702,143 K957R probably damaging Het
Klc4 T A 17: 46,636,679 I366F probably damaging Het
Lamb2 A G 9: 108,488,199 probably null Het
Madd T C 2: 91,178,104 D151G probably benign Het
Man2a1 C A 17: 64,710,826 A689E probably damaging Het
Mapk8ip1 C A 2: 92,389,244 G81C probably damaging Het
Msmp T C 4: 43,583,909 Y48C probably damaging Het
Muc6 T C 7: 141,648,821 N567S probably damaging Het
Nrap A G 19: 56,354,221 Y748H probably damaging Het
Nrap C T 19: 56,379,875 A192T possibly damaging Het
Olfr1138 G C 2: 87,737,896 Q143E possibly damaging Het
Olfr1370 T A 13: 21,072,690 T204S possibly damaging Het
Olfr1384 T A 11: 49,514,165 F176I possibly damaging Het
Pcdhb8 T G 18: 37,357,169 D633E possibly damaging Het
Pcdhb9 G A 18: 37,403,154 V734M probably damaging Het
Plscr1 T C 9: 92,259,321 Y21H unknown Het
Ptk2b G T 14: 66,163,066 P767T probably damaging Het
Ptprz1 T C 6: 23,051,990 Y1424H probably damaging Het
Sec31a T A 5: 100,386,184 Q118L probably benign Het
Selenop A G 15: 3,274,734 S21G probably damaging Het
Shank1 G A 7: 44,352,253 S1132N unknown Het
Slf1 A G 13: 77,084,383 L534P probably damaging Het
Sparcl1 T A 5: 104,085,147 H596L probably damaging Het
Spocd1 C T 4: 129,957,108 probably null Het
Tbc1d24 A T 17: 24,185,993 I59N probably damaging Het
Tctex1d1 A G 4: 102,988,667 N32S probably benign Het
Tjp3 G A 10: 81,277,276 T580I probably benign Het
Tmem154 C T 3: 84,684,296 T51M possibly damaging Het
Tmem8b G A 4: 43,690,246 V894I probably benign Het
Trbv20 A T 6: 41,188,906 L88F possibly damaging Het
Tssk2 A C 16: 17,898,948 I72L possibly damaging Het
Tub T A 7: 109,027,058 I267N probably damaging Het
Vmn2r104 A T 17: 20,041,567 F434I possibly damaging Het
Vmn2r42 T C 7: 8,192,734 N471S probably damaging Het
Vmn2r94 C G 17: 18,258,123 G121R probably damaging Het
Wdr72 T C 9: 74,148,223 S245P probably damaging Het
Zbtb42 A G 12: 112,679,535 Y48C probably damaging Het
Zdbf2 T C 1: 63,304,433 V657A possibly damaging Het
Zfp768 A T 7: 127,344,091 C288* probably null Het
Zfp988 T A 4: 147,332,013 C301* probably null Het
Other mutations in Cyp4a31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Cyp4a31 APN 4 115574974 unclassified probably benign
IGL01682:Cyp4a31 APN 4 115578031 missense probably damaging 0.97
IGL02112:Cyp4a31 APN 4 115570983 missense probably damaging 1.00
IGL02292:Cyp4a31 APN 4 115566501 missense probably damaging 0.98
IGL02343:Cyp4a31 APN 4 115563829 missense probably damaging 1.00
IGL02508:Cyp4a31 APN 4 115571064 missense probably damaging 1.00
IGL03094:Cyp4a31 APN 4 115578108 utr 3 prime probably benign
IGL03493:Cyp4a31 APN 4 115570755 splice site probably null
R0400:Cyp4a31 UTSW 4 115563718 start codon destroyed probably null 1.00
R1263:Cyp4a31 UTSW 4 115574711 missense probably benign 0.01
R1508:Cyp4a31 UTSW 4 115565053 missense possibly damaging 0.53
R1523:Cyp4a31 UTSW 4 115569754 missense probably benign 0.23
R1822:Cyp4a31 UTSW 4 115566613 splice site probably null
R1832:Cyp4a31 UTSW 4 115569731 missense probably benign
R1872:Cyp4a31 UTSW 4 115574736 missense probably damaging 0.99
R2351:Cyp4a31 UTSW 4 115571313 missense possibly damaging 0.95
R2426:Cyp4a31 UTSW 4 115571016 missense probably damaging 0.98
R2993:Cyp4a31 UTSW 4 115569820 missense probably benign 0.03
R3743:Cyp4a31 UTSW 4 115566519 missense possibly damaging 0.95
R3812:Cyp4a31 UTSW 4 115566509 missense probably benign
R3963:Cyp4a31 UTSW 4 115574772 unclassified probably benign
R4211:Cyp4a31 UTSW 4 115565013 missense probably benign 0.01
R4814:Cyp4a31 UTSW 4 115570269 missense probably damaging 1.00
R6255:Cyp4a31 UTSW 4 115574920 missense possibly damaging 0.82
R6330:Cyp4a31 UTSW 4 115563877 missense probably damaging 0.99
R6433:Cyp4a31 UTSW 4 115570269 missense probably damaging 1.00
R6602:Cyp4a31 UTSW 4 115569707 critical splice acceptor site probably null
R6844:Cyp4a31 UTSW 4 115563792 missense probably null 0.00
R7154:Cyp4a31 UTSW 4 115574766 critical splice donor site probably null
R7300:Cyp4a31 UTSW 4 115570271 missense probably benign 0.03
R8188:Cyp4a31 UTSW 4 115569746 missense probably benign 0.29
X0020:Cyp4a31 UTSW 4 115565109 missense probably benign 0.06
X0021:Cyp4a31 UTSW 4 115577961 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGATGGATCCTCTATCACCTG -3'
(R):5'- GCAGAACTGGAGATCATTTAAGTG -3'

Sequencing Primer
(F):5'- GGATCCTCTATCACCTGGTAAGAG -3'
(R):5'- ACTGGAGATCATTTAAGTGTAGAGG -3'
Posted On2018-02-28