Incidental Mutation 'R6245:Hadha'
ID505517
Institutional Source Beutler Lab
Gene Symbol Hadha
Ensembl Gene ENSMUSG00000025745
Gene Namehydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/enoyl-Coenzyme A hydratase (trifunctional protein), alpha subunit
SynonymsMtpa
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6245 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location30118304-30155162 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 30120044 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058045] [ENSMUST00000156859]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000026843
Predicted Effect probably benign
Transcript: ENSMUST00000058045
SMART Domains Protein: ENSMUSP00000054208
Gene: ENSMUSG00000044576

DomainStartEndE-ValueType
Pfam:CABIT 29 337 1.2e-77 PFAM
low complexity region 379 405 N/A INTRINSIC
low complexity region 464 486 N/A INTRINSIC
low complexity region 524 534 N/A INTRINSIC
low complexity region 538 553 N/A INTRINSIC
low complexity region 569 588 N/A INTRINSIC
low complexity region 640 663 N/A INTRINSIC
low complexity region 674 684 N/A INTRINSIC
low complexity region 686 696 N/A INTRINSIC
PDB:2DKZ|A 794 878 3e-30 PDB
Blast:SAM 812 879 6e-35 BLAST
SCOP:d1kw4a_ 816 877 1e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126081
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132486
Predicted Effect probably null
Transcript: ENSMUST00000156859
SMART Domains Protein: ENSMUSP00000120976
Gene: ENSMUSG00000025745

DomainStartEndE-ValueType
Pfam:ECH_1 44 297 3.6e-42 PFAM
Pfam:ECH_2 49 225 8.6e-27 PFAM
Pfam:3HCDH_N 363 542 1e-54 PFAM
Pfam:3HCDH 544 639 7.7e-29 PFAM
low complexity region 706 720 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha subunit of the mitochondrial trifunctional protein, which catalyzes the last three steps of mitochondrial beta-oxidation of long chain fatty acids. The mitochondrial membrane-bound heterocomplex is composed of four alpha and four beta subunits, with the alpha subunit catalyzing the 3-hydroxyacyl-CoA dehydrogenase and enoyl-CoA hydratase activities. Mutations in this gene result in trifunctional protein deficiency or LCHAD deficiency. The genes of the alpha and beta subunits of the mitochondrial trifunctional protein are located adjacent to each other in the human genome in a head-to-head orientation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die within 36 hours with hypoglycemia and liver steatosis. Liver steatosis and insulin resistance develop in heterozygotes with age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,178,418 Y218H probably benign Het
Abca9 A G 11: 110,135,423 I937T probably damaging Het
Adgrl3 T A 5: 81,688,556 N720K probably benign Het
Akr1c21 T G 13: 4,575,232 V54G possibly damaging Het
Alpi G T 1: 87,100,834 D111E probably damaging Het
Armc3 C T 2: 19,248,705 T219M probably damaging Het
Bms1 T A 6: 118,396,836 E780V probably damaging Het
Ccdc159 T C 9: 21,935,568 S244P probably damaging Het
Cdon T C 9: 35,476,939 W737R probably damaging Het
Chdh T A 14: 30,035,305 V395D probably damaging Het
Col22a1 C A 15: 71,973,816 D366Y probably damaging Het
Crnkl1 T A 2: 145,928,131 N264I probably benign Het
Ctnnd2 T C 15: 30,905,748 L847P probably damaging Het
Cyp4a31 A C 4: 115,571,348 T382P possibly damaging Het
Dcaf8 A T 1: 172,165,867 M1L probably benign Het
Ddx31 T A 2: 28,844,982 F52I probably benign Het
Eps15 G A 4: 109,382,866 S852N possibly damaging Het
Fchsd1 A T 18: 37,962,775 L552Q probably damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Frem2 T C 3: 53,655,824 M421V probably benign Het
Gm1110 T G 9: 26,920,747 H36P probably benign Het
Gm11639 A T 11: 104,785,008 Y1542F probably benign Het
Hspa4 C T 11: 53,262,939 E702K probably benign Het
Intu C A 3: 40,675,326 T362K probably damaging Het
Jaml C T 9: 45,097,919 T248I probably damaging Het
Kcnj1 A T 9: 32,396,867 S176C probably damaging Het
Kcnj9 A G 1: 172,326,137 L140P probably damaging Het
Kif7 T C 7: 79,702,143 K957R probably damaging Het
Klc4 T A 17: 46,636,679 I366F probably damaging Het
Lamb2 A G 9: 108,488,199 probably null Het
Madd T C 2: 91,178,104 D151G probably benign Het
Man2a1 C A 17: 64,710,826 A689E probably damaging Het
Mapk8ip1 C A 2: 92,389,244 G81C probably damaging Het
Msmp T C 4: 43,583,909 Y48C probably damaging Het
Muc6 T C 7: 141,648,821 N567S probably damaging Het
Nrap C T 19: 56,379,875 A192T possibly damaging Het
Nrap A G 19: 56,354,221 Y748H probably damaging Het
Olfr1138 G C 2: 87,737,896 Q143E possibly damaging Het
Olfr1370 T A 13: 21,072,690 T204S possibly damaging Het
Olfr1384 T A 11: 49,514,165 F176I possibly damaging Het
Pcdhb8 T G 18: 37,357,169 D633E possibly damaging Het
Pcdhb9 G A 18: 37,403,154 V734M probably damaging Het
Plscr1 T C 9: 92,259,321 Y21H unknown Het
Ptk2b G T 14: 66,163,066 P767T probably damaging Het
Ptprz1 T C 6: 23,051,990 Y1424H probably damaging Het
Sec31a T A 5: 100,386,184 Q118L probably benign Het
Selenop A G 15: 3,274,734 S21G probably damaging Het
Shank1 G A 7: 44,352,253 S1132N unknown Het
Slf1 A G 13: 77,084,383 L534P probably damaging Het
Sparcl1 T A 5: 104,085,147 H596L probably damaging Het
Spocd1 C T 4: 129,957,108 probably null Het
Tbc1d24 A T 17: 24,185,993 I59N probably damaging Het
Tctex1d1 A G 4: 102,988,667 N32S probably benign Het
Tjp3 G A 10: 81,277,276 T580I probably benign Het
Tmem154 C T 3: 84,684,296 T51M possibly damaging Het
Tmem8b G A 4: 43,690,246 V894I probably benign Het
Trbv20 A T 6: 41,188,906 L88F possibly damaging Het
Tssk2 A C 16: 17,898,948 I72L possibly damaging Het
Tub T A 7: 109,027,058 I267N probably damaging Het
Vmn2r104 A T 17: 20,041,567 F434I possibly damaging Het
Vmn2r42 T C 7: 8,192,734 N471S probably damaging Het
Vmn2r94 C G 17: 18,258,123 G121R probably damaging Het
Wdr72 T C 9: 74,148,223 S245P probably damaging Het
Zbtb42 A G 12: 112,679,535 Y48C probably damaging Het
Zdbf2 T C 1: 63,304,433 V657A possibly damaging Het
Zfp768 A T 7: 127,344,091 C288* probably null Het
Zfp988 T A 4: 147,332,013 C301* probably null Het
Other mutations in Hadha
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Hadha APN 5 30120147 missense possibly damaging 0.94
IGL00435:Hadha APN 5 30122173 missense probably benign 0.12
IGL01413:Hadha APN 5 30141027 missense probably benign 0.01
IGL01715:Hadha APN 5 30120084 missense probably damaging 1.00
IGL02065:Hadha APN 5 30142845 splice site probably benign
IGL02316:Hadha APN 5 30126567 missense probably benign 0.04
IGL02366:Hadha APN 5 30135050 missense probably benign 0.01
IGL02453:Hadha APN 5 30144306 splice site probably benign
IGL02611:Hadha APN 5 30128943 splice site probably benign
IGL03127:Hadha APN 5 30134186 splice site probably benign
IGL03181:Hadha APN 5 30121526 missense probably benign 0.20
R1381:Hadha UTSW 5 30128836 missense probably benign
R1501:Hadha UTSW 5 30128806 missense probably benign 0.02
R2060:Hadha UTSW 5 30128836 missense probably benign 0.30
R3764:Hadha UTSW 5 30144209 missense probably damaging 1.00
R3778:Hadha UTSW 5 30120129 missense probably damaging 0.98
R5025:Hadha UTSW 5 30154961 unclassified probably benign
R5523:Hadha UTSW 5 30145254 missense possibly damaging 0.78
R5870:Hadha UTSW 5 30144286 missense possibly damaging 0.61
R6054:Hadha UTSW 5 30123684 missense probably benign 0.00
R6144:Hadha UTSW 5 30140996 missense probably benign 0.04
R6495:Hadha UTSW 5 30120050 missense probably benign 0.03
R6862:Hadha UTSW 5 30147979 critical splice donor site probably null
R7038:Hadha UTSW 5 30120000 splice site probably null
R7200:Hadha UTSW 5 30145317 missense probably benign 0.25
R7215:Hadha UTSW 5 30119842 missense probably benign 0.00
R7267:Hadha UTSW 5 30122757 missense probably damaging 1.00
R7414:Hadha UTSW 5 30126612 missense possibly damaging 0.95
R8172:Hadha UTSW 5 30145287 missense probably damaging 0.97
R8429:Hadha UTSW 5 30144257 missense probably benign 0.00
R8516:Hadha UTSW 5 30126584 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGGCATGGGGTAAACTG -3'
(R):5'- AGGTGCTCAGTTCACATTGG -3'

Sequencing Primer
(F):5'- ACTGTGTTCCATAGGCAGAC -3'
(R):5'- TGTAGTACACCCTGGCCACTG -3'
Posted On2018-02-28