Incidental Mutation 'R6245:Sec31a'
ID505519
Institutional Source Beutler Lab
Gene Symbol Sec31a
Ensembl Gene ENSMUSG00000035325
Gene NameSec31 homolog A (S. cerevisiae)
SynonymsSec31l1, 1810024J13Rik
MMRRC Submission
Accession Numbers

Genbank: NM_026969; MGI: 1916412; Ensembl: ENSMUST00000046296, ENSMUST00000094578, ENSMUST00000112918

Is this an essential gene? Probably essential (E-score: 0.899) question?
Stock #R6245 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location100361649-100416234 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 100386184 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 118 (Q118L)
Ref Sequence ENSEMBL: ENSMUSP00000138129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094578] [ENSMUST00000182886] [ENSMUST00000183247]
Predicted Effect probably benign
Transcript: ENSMUST00000094578
AA Change: Q548L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000092157
Gene: ENSMUSG00000035325
AA Change: Q548L

DomainStartEndE-ValueType
WD40 56 102 1.59e1 SMART
WD40 111 151 5.15e-2 SMART
WD40 158 197 5.16e-1 SMART
WD40 200 245 6.63e0 SMART
WD40 249 289 1.95e-2 SMART
WD40 292 332 4.24e-3 SMART
low complexity region 363 373 N/A INTRINSIC
Pfam:Sec16_C 572 769 3.5e-7 PFAM
low complexity region 866 882 N/A INTRINSIC
low complexity region 930 949 N/A INTRINSIC
low complexity region 953 975 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182812
Predicted Effect probably benign
Transcript: ENSMUST00000182886
AA Change: Q509L

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000138213
Gene: ENSMUSG00000035325
AA Change: Q509L

DomainStartEndE-ValueType
WD40 56 102 1e-1 SMART
WD40 111 151 3.3e-4 SMART
WD40 158 197 3.2e-3 SMART
WD40 200 245 4.1e-2 SMART
WD40 249 289 1.2e-4 SMART
WD40 292 332 2.6e-5 SMART
low complexity region 363 373 N/A INTRINSIC
Pfam:Sec16_C 532 731 2.1e-6 PFAM
low complexity region 827 843 N/A INTRINSIC
low complexity region 891 910 N/A INTRINSIC
low complexity region 914 936 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000182988
AA Change: Q248L
Predicted Effect probably benign
Transcript: ENSMUST00000183247
AA Change: Q118L

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000138129
Gene: ENSMUSG00000035325
AA Change: Q118L

DomainStartEndE-ValueType
Pfam:Sec16_C 141 248 1.5e-7 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares similarity with the yeast Sec31 protein, and is a component of the outer layer of the coat protein complex II (COPII). The encoded protein is involved in vesicle budding from the endoplasmic reticulum (ER) and contains multiple WD repeats near the N-terminus and a proline-rich region in the C-terminal half. It associates with the protein encoded by the SEC13 homolog, nuclear pore and COPII coat complex component (SEC13), and is required for ER-Golgi transport. Monoubiquitylation of this protein by CUL3-KLHL12 was found to regulate the size of COPII coats to accommodate unusually shaped cargo. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
Allele List at MGI

All alleles(31) : Gene trapped(31)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,178,418 Y218H probably benign Het
Abca9 A G 11: 110,135,423 I937T probably damaging Het
Adgrl3 T A 5: 81,688,556 N720K probably benign Het
Akr1c21 T G 13: 4,575,232 V54G possibly damaging Het
Alpi G T 1: 87,100,834 D111E probably damaging Het
Armc3 C T 2: 19,248,705 T219M probably damaging Het
Bms1 T A 6: 118,396,836 E780V probably damaging Het
Ccdc159 T C 9: 21,935,568 S244P probably damaging Het
Cdon T C 9: 35,476,939 W737R probably damaging Het
Chdh T A 14: 30,035,305 V395D probably damaging Het
Col22a1 C A 15: 71,973,816 D366Y probably damaging Het
Crnkl1 T A 2: 145,928,131 N264I probably benign Het
Ctnnd2 T C 15: 30,905,748 L847P probably damaging Het
Cyp4a31 A C 4: 115,571,348 T382P possibly damaging Het
Dcaf8 A T 1: 172,165,867 M1L probably benign Het
Ddx31 T A 2: 28,844,982 F52I probably benign Het
Eps15 G A 4: 109,382,866 S852N possibly damaging Het
Fchsd1 A T 18: 37,962,775 L552Q probably damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Frem2 T C 3: 53,655,824 M421V probably benign Het
Gm1110 T G 9: 26,920,747 H36P probably benign Het
Gm11639 A T 11: 104,785,008 Y1542F probably benign Het
Hadha C T 5: 30,120,044 probably null Het
Hspa4 C T 11: 53,262,939 E702K probably benign Het
Intu C A 3: 40,675,326 T362K probably damaging Het
Jaml C T 9: 45,097,919 T248I probably damaging Het
Kcnj1 A T 9: 32,396,867 S176C probably damaging Het
Kcnj9 A G 1: 172,326,137 L140P probably damaging Het
Kif7 T C 7: 79,702,143 K957R probably damaging Het
Klc4 T A 17: 46,636,679 I366F probably damaging Het
Lamb2 A G 9: 108,488,199 probably null Het
Madd T C 2: 91,178,104 D151G probably benign Het
Man2a1 C A 17: 64,710,826 A689E probably damaging Het
Mapk8ip1 C A 2: 92,389,244 G81C probably damaging Het
Msmp T C 4: 43,583,909 Y48C probably damaging Het
Muc6 T C 7: 141,648,821 N567S probably damaging Het
Nrap A G 19: 56,354,221 Y748H probably damaging Het
Nrap C T 19: 56,379,875 A192T possibly damaging Het
Olfr1138 G C 2: 87,737,896 Q143E possibly damaging Het
Olfr1370 T A 13: 21,072,690 T204S possibly damaging Het
Olfr1384 T A 11: 49,514,165 F176I possibly damaging Het
Pcdhb8 T G 18: 37,357,169 D633E possibly damaging Het
Pcdhb9 G A 18: 37,403,154 V734M probably damaging Het
Plscr1 T C 9: 92,259,321 Y21H unknown Het
Ptk2b G T 14: 66,163,066 P767T probably damaging Het
Ptprz1 T C 6: 23,051,990 Y1424H probably damaging Het
Selenop A G 15: 3,274,734 S21G probably damaging Het
Shank1 G A 7: 44,352,253 S1132N unknown Het
Slf1 A G 13: 77,084,383 L534P probably damaging Het
Sparcl1 T A 5: 104,085,147 H596L probably damaging Het
Spocd1 C T 4: 129,957,108 probably null Het
Tbc1d24 A T 17: 24,185,993 I59N probably damaging Het
Tctex1d1 A G 4: 102,988,667 N32S probably benign Het
Tjp3 G A 10: 81,277,276 T580I probably benign Het
Tmem154 C T 3: 84,684,296 T51M possibly damaging Het
Tmem8b G A 4: 43,690,246 V894I probably benign Het
Trbv20 A T 6: 41,188,906 L88F possibly damaging Het
Tssk2 A C 16: 17,898,948 I72L possibly damaging Het
Tub T A 7: 109,027,058 I267N probably damaging Het
Vmn2r104 A T 17: 20,041,567 F434I possibly damaging Het
Vmn2r42 T C 7: 8,192,734 N471S probably damaging Het
Vmn2r94 C G 17: 18,258,123 G121R probably damaging Het
Wdr72 T C 9: 74,148,223 S245P probably damaging Het
Zbtb42 A G 12: 112,679,535 Y48C probably damaging Het
Zdbf2 T C 1: 63,304,433 V657A possibly damaging Het
Zfp768 A T 7: 127,344,091 C288* probably null Het
Zfp988 T A 4: 147,332,013 C301* probably null Het
Other mutations in Sec31a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00657:Sec31a APN 5 100404017 nonsense probably null
IGL01610:Sec31a APN 5 100402358 splice site probably benign
IGL01804:Sec31a APN 5 100375206 critical splice donor site probably null
IGL02026:Sec31a APN 5 100369626 missense probably benign 0.04
IGL02150:Sec31a APN 5 100386125 splice site probably benign
IGL02237:Sec31a APN 5 100362055 missense probably damaging 1.00
IGL02469:Sec31a APN 5 100385255 missense probably benign 0.02
IGL02512:Sec31a APN 5 100407193 missense probably damaging 0.99
control UTSW 5 100362173 missense probably damaging 1.00
Discipline UTSW 5 100363878 missense probably damaging 1.00
D3080:Sec31a UTSW 5 100363832 missense probably damaging 1.00
PIT4142001:Sec31a UTSW 5 100407275 missense probably damaging 1.00
R0366:Sec31a UTSW 5 100382766 missense probably damaging 1.00
R0453:Sec31a UTSW 5 100404118 splice site probably benign
R0511:Sec31a UTSW 5 100375240 missense probably benign 0.01
R0546:Sec31a UTSW 5 100404070 missense probably damaging 1.00
R0675:Sec31a UTSW 5 100393207 missense probably damaging 0.97
R0678:Sec31a UTSW 5 100407225 missense possibly damaging 0.74
R0975:Sec31a UTSW 5 100395904 splice site probably null
R1146:Sec31a UTSW 5 100362173 missense probably damaging 1.00
R1146:Sec31a UTSW 5 100362173 missense probably damaging 1.00
R1540:Sec31a UTSW 5 100375319 missense probably damaging 1.00
R1616:Sec31a UTSW 5 100386195 missense possibly damaging 0.88
R1780:Sec31a UTSW 5 100381336 splice site probably null
R2472:Sec31a UTSW 5 100385205 missense probably damaging 1.00
R3689:Sec31a UTSW 5 100382907 missense probably damaging 1.00
R4515:Sec31a UTSW 5 100365958 missense probably damaging 0.99
R4801:Sec31a UTSW 5 100393363 missense probably damaging 0.96
R4802:Sec31a UTSW 5 100393363 missense probably damaging 0.96
R4896:Sec31a UTSW 5 100368333 missense probably damaging 1.00
R5004:Sec31a UTSW 5 100368333 missense probably damaging 1.00
R5053:Sec31a UTSW 5 100393214 missense possibly damaging 0.94
R5158:Sec31a UTSW 5 100393321 missense probably damaging 0.99
R5191:Sec31a UTSW 5 100405511 missense possibly damaging 0.75
R5222:Sec31a UTSW 5 100382895 missense probably benign
R5405:Sec31a UTSW 5 100383798 nonsense probably null
R5436:Sec31a UTSW 5 100363839 missense probably damaging 0.98
R5577:Sec31a UTSW 5 100402274 missense possibly damaging 0.95
R6005:Sec31a UTSW 5 100363878 missense probably damaging 1.00
R6184:Sec31a UTSW 5 100369594 critical splice donor site probably null
R6475:Sec31a UTSW 5 100385270 missense probably damaging 1.00
R6476:Sec31a UTSW 5 100386149 missense probably benign 0.03
R6744:Sec31a UTSW 5 100392499 missense possibly damaging 0.47
R6804:Sec31a UTSW 5 100382812 missense probably benign 0.03
R6911:Sec31a UTSW 5 100393264 missense possibly damaging 0.92
R6936:Sec31a UTSW 5 100392510 missense probably benign
R7345:Sec31a UTSW 5 100385270 missense probably damaging 1.00
R7760:Sec31a UTSW 5 100392628 missense probably damaging 1.00
R7898:Sec31a UTSW 5 100399477 missense probably damaging 0.99
R8088:Sec31a UTSW 5 100378862 missense
X0003:Sec31a UTSW 5 100399354 missense probably damaging 0.98
Z1177:Sec31a UTSW 5 100383845 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACAACACGTTCTAGTTATGCC -3'
(R):5'- AAGGCCCCGATTCTAGTCTAAAC -3'

Sequencing Primer
(F):5'- GCAACTGAAATCCCAGGTCTTGTG -3'
(R):5'- CTTGGATATGGGAACTTTGTGAAAC -3'
Posted On2018-02-28