Incidental Mutation 'R6245:Kif7'
ID505526
Institutional Source Beutler Lab
Gene Symbol Kif7
Ensembl Gene ENSMUSG00000050382
Gene Namekinesin family member 7
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6245 (G1)
Quality Score216.009
Status Not validated
Chromosome7
Chromosomal Location79698098-79715720 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79702143 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 957 (K957R)
Ref Sequence ENSEMBL: ENSMUSP00000139224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035977] [ENSMUST00000059836] [ENSMUST00000178048] [ENSMUST00000183846] [ENSMUST00000184137] [ENSMUST00000206622]
Predicted Effect probably benign
Transcript: ENSMUST00000035977
SMART Domains Protein: ENSMUSP00000041377
Gene: ENSMUSG00000046591

DomainStartEndE-ValueType
low complexity region 23 31 N/A INTRINSIC
Pfam:Treslin_N 211 1005 N/A PFAM
low complexity region 1186 1197 N/A INTRINSIC
low complexity region 1220 1235 N/A INTRINSIC
low complexity region 1339 1359 N/A INTRINSIC
low complexity region 1472 1480 N/A INTRINSIC
low complexity region 1496 1514 N/A INTRINSIC
low complexity region 1630 1643 N/A INTRINSIC
low complexity region 1694 1707 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000059836
AA Change: K957R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000061806
Gene: ENSMUSG00000050382
AA Change: K957R

DomainStartEndE-ValueType
KISc 13 357 2.88e-143 SMART
low complexity region 391 410 N/A INTRINSIC
Blast:KISc 413 481 1e-19 BLAST
Blast:KISc 482 518 3e-11 BLAST
low complexity region 523 540 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 621 636 N/A INTRINSIC
low complexity region 669 685 N/A INTRINSIC
Blast:KISc 780 879 2e-15 BLAST
low complexity region 927 944 N/A INTRINSIC
low complexity region 979 993 N/A INTRINSIC
low complexity region 1049 1061 N/A INTRINSIC
coiled coil region 1113 1139 N/A INTRINSIC
coiled coil region 1186 1205 N/A INTRINSIC
low complexity region 1293 1304 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000178048
AA Change: K958R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000136993
Gene: ENSMUSG00000050382
AA Change: K958R

DomainStartEndE-ValueType
KISc 13 357 2.88e-143 SMART
low complexity region 391 410 N/A INTRINSIC
Blast:KISc 413 481 1e-19 BLAST
Blast:KISc 482 518 3e-11 BLAST
low complexity region 523 540 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 621 636 N/A INTRINSIC
low complexity region 669 685 N/A INTRINSIC
Blast:KISc 780 879 2e-15 BLAST
low complexity region 908 918 N/A INTRINSIC
low complexity region 928 945 N/A INTRINSIC
low complexity region 980 994 N/A INTRINSIC
low complexity region 1050 1062 N/A INTRINSIC
coiled coil region 1114 1140 N/A INTRINSIC
coiled coil region 1187 1206 N/A INTRINSIC
low complexity region 1294 1305 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183846
AA Change: K958R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139359
Gene: ENSMUSG00000050382
AA Change: K958R

DomainStartEndE-ValueType
KISc 13 357 2.88e-143 SMART
low complexity region 391 410 N/A INTRINSIC
Blast:KISc 413 481 1e-19 BLAST
Blast:KISc 482 518 3e-11 BLAST
low complexity region 523 540 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 621 636 N/A INTRINSIC
low complexity region 669 685 N/A INTRINSIC
Blast:KISc 780 879 2e-15 BLAST
low complexity region 908 918 N/A INTRINSIC
low complexity region 928 945 N/A INTRINSIC
low complexity region 980 994 N/A INTRINSIC
low complexity region 1050 1062 N/A INTRINSIC
coiled coil region 1114 1140 N/A INTRINSIC
coiled coil region 1187 1206 N/A INTRINSIC
low complexity region 1294 1305 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000184137
AA Change: K957R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139224
Gene: ENSMUSG00000050382
AA Change: K957R

DomainStartEndE-ValueType
KISc 13 357 2.88e-143 SMART
low complexity region 391 410 N/A INTRINSIC
Blast:KISc 413 481 1e-19 BLAST
Blast:KISc 482 518 3e-11 BLAST
low complexity region 523 540 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 621 636 N/A INTRINSIC
low complexity region 669 685 N/A INTRINSIC
Blast:KISc 780 879 2e-15 BLAST
low complexity region 927 944 N/A INTRINSIC
low complexity region 979 993 N/A INTRINSIC
low complexity region 1049 1061 N/A INTRINSIC
coiled coil region 1113 1139 N/A INTRINSIC
coiled coil region 1186 1205 N/A INTRINSIC
low complexity region 1293 1304 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206622
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cilia-associated protein belonging to the kinesin family. This protein plays a role in the sonic hedgehog (SHH) signaling pathway through the regulation of GLI transcription factors. It functions as a negative regulator of the SHH pathway by preventing inappropriate activation of GLI2 in the absence of ligand, and as a positive regulator by preventing the processing of GLI3 into its repressor form. Mutations in this gene have been associated with various ciliopathies. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality, exencephaly, polydactyly, abnormal sternum, edema, abnormal ribs, and abnormal neurogenesis. Mice homozygous for an ENU-induced allele exhibit prenatal lethality, polydactyly, and abnormal neural tube development and neurogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,178,418 Y218H probably benign Het
Abca9 A G 11: 110,135,423 I937T probably damaging Het
Adgrl3 T A 5: 81,688,556 N720K probably benign Het
Akr1c21 T G 13: 4,575,232 V54G possibly damaging Het
Alpi G T 1: 87,100,834 D111E probably damaging Het
Armc3 C T 2: 19,248,705 T219M probably damaging Het
Bms1 T A 6: 118,396,836 E780V probably damaging Het
Ccdc159 T C 9: 21,935,568 S244P probably damaging Het
Cdon T C 9: 35,476,939 W737R probably damaging Het
Chdh T A 14: 30,035,305 V395D probably damaging Het
Col22a1 C A 15: 71,973,816 D366Y probably damaging Het
Crnkl1 T A 2: 145,928,131 N264I probably benign Het
Ctnnd2 T C 15: 30,905,748 L847P probably damaging Het
Cyp4a31 A C 4: 115,571,348 T382P possibly damaging Het
Dcaf8 A T 1: 172,165,867 M1L probably benign Het
Ddx31 T A 2: 28,844,982 F52I probably benign Het
Eps15 G A 4: 109,382,866 S852N possibly damaging Het
Fchsd1 A T 18: 37,962,775 L552Q probably damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Frem2 T C 3: 53,655,824 M421V probably benign Het
Gm1110 T G 9: 26,920,747 H36P probably benign Het
Gm11639 A T 11: 104,785,008 Y1542F probably benign Het
Hadha C T 5: 30,120,044 probably null Het
Hspa4 C T 11: 53,262,939 E702K probably benign Het
Intu C A 3: 40,675,326 T362K probably damaging Het
Jaml C T 9: 45,097,919 T248I probably damaging Het
Kcnj1 A T 9: 32,396,867 S176C probably damaging Het
Kcnj9 A G 1: 172,326,137 L140P probably damaging Het
Klc4 T A 17: 46,636,679 I366F probably damaging Het
Lamb2 A G 9: 108,488,199 probably null Het
Madd T C 2: 91,178,104 D151G probably benign Het
Man2a1 C A 17: 64,710,826 A689E probably damaging Het
Mapk8ip1 C A 2: 92,389,244 G81C probably damaging Het
Msmp T C 4: 43,583,909 Y48C probably damaging Het
Muc6 T C 7: 141,648,821 N567S probably damaging Het
Nrap A G 19: 56,354,221 Y748H probably damaging Het
Nrap C T 19: 56,379,875 A192T possibly damaging Het
Olfr1138 G C 2: 87,737,896 Q143E possibly damaging Het
Olfr1370 T A 13: 21,072,690 T204S possibly damaging Het
Olfr1384 T A 11: 49,514,165 F176I possibly damaging Het
Pcdhb8 T G 18: 37,357,169 D633E possibly damaging Het
Pcdhb9 G A 18: 37,403,154 V734M probably damaging Het
Plscr1 T C 9: 92,259,321 Y21H unknown Het
Ptk2b G T 14: 66,163,066 P767T probably damaging Het
Ptprz1 T C 6: 23,051,990 Y1424H probably damaging Het
Sec31a T A 5: 100,386,184 Q118L probably benign Het
Selenop A G 15: 3,274,734 S21G probably damaging Het
Shank1 G A 7: 44,352,253 S1132N unknown Het
Slf1 A G 13: 77,084,383 L534P probably damaging Het
Sparcl1 T A 5: 104,085,147 H596L probably damaging Het
Spocd1 C T 4: 129,957,108 probably null Het
Tbc1d24 A T 17: 24,185,993 I59N probably damaging Het
Tctex1d1 A G 4: 102,988,667 N32S probably benign Het
Tjp3 G A 10: 81,277,276 T580I probably benign Het
Tmem154 C T 3: 84,684,296 T51M possibly damaging Het
Tmem8b G A 4: 43,690,246 V894I probably benign Het
Trbv20 A T 6: 41,188,906 L88F possibly damaging Het
Tssk2 A C 16: 17,898,948 I72L possibly damaging Het
Tub T A 7: 109,027,058 I267N probably damaging Het
Vmn2r104 A T 17: 20,041,567 F434I possibly damaging Het
Vmn2r42 T C 7: 8,192,734 N471S probably damaging Het
Vmn2r94 C G 17: 18,258,123 G121R probably damaging Het
Wdr72 T C 9: 74,148,223 S245P probably damaging Het
Zbtb42 A G 12: 112,679,535 Y48C probably damaging Het
Zdbf2 T C 1: 63,304,433 V657A possibly damaging Het
Zfp768 A T 7: 127,344,091 C288* probably null Het
Zfp988 T A 4: 147,332,013 C301* probably null Het
Other mutations in Kif7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01545:Kif7 APN 7 79702278 missense probably damaging 0.99
IGL01551:Kif7 APN 7 79710566 critical splice acceptor site probably null
IGL01897:Kif7 APN 7 79701052 missense probably damaging 0.97
IGL02541:Kif7 APN 7 79710880 missense possibly damaging 0.46
IGL02873:Kif7 APN 7 79706759 missense probably damaging 1.00
IGL03409:Kif7 APN 7 79707553 missense probably benign 0.04
PIT4131001:Kif7 UTSW 7 79711069 missense probably damaging 1.00
R0053:Kif7 UTSW 7 79702179 missense probably benign
R0243:Kif7 UTSW 7 79699560 missense possibly damaging 0.66
R0280:Kif7 UTSW 7 79698823 missense probably benign
R0492:Kif7 UTSW 7 79713881 missense probably damaging 1.00
R0563:Kif7 UTSW 7 79702272 missense probably benign 0.00
R1557:Kif7 UTSW 7 79714157 start codon destroyed probably null 0.01
R1637:Kif7 UTSW 7 79702837 missense probably damaging 1.00
R1889:Kif7 UTSW 7 79710463 missense probably damaging 1.00
R1934:Kif7 UTSW 7 79711538 missense probably benign 0.03
R1988:Kif7 UTSW 7 79699241 missense probably benign
R2259:Kif7 UTSW 7 79711589 missense probably damaging 1.00
R2418:Kif7 UTSW 7 79698693 missense probably benign 0.05
R2419:Kif7 UTSW 7 79698693 missense probably benign 0.05
R2511:Kif7 UTSW 7 79702264 missense probably damaging 1.00
R2975:Kif7 UTSW 7 79710260 missense probably damaging 1.00
R3711:Kif7 UTSW 7 79710892 missense probably benign 0.40
R3813:Kif7 UTSW 7 79713890 missense probably damaging 1.00
R4258:Kif7 UTSW 7 79710513 nonsense probably null
R4543:Kif7 UTSW 7 79707548 missense probably benign 0.03
R4648:Kif7 UTSW 7 79709191 missense probably damaging 1.00
R5650:Kif7 UTSW 7 79710979 missense probably damaging 1.00
R5941:Kif7 UTSW 7 79711132 intron probably benign
R6025:Kif7 UTSW 7 79704640 missense probably benign 0.34
R6056:Kif7 UTSW 7 79714094 missense possibly damaging 0.63
R6392:Kif7 UTSW 7 79702186 missense probably damaging 1.00
R6464:Kif7 UTSW 7 79714094 missense possibly damaging 0.63
R7513:Kif7 UTSW 7 79711028 missense possibly damaging 0.65
R7728:Kif7 UTSW 7 79710730 missense possibly damaging 0.80
R8158:Kif7 UTSW 7 79704694 missense probably damaging 1.00
X0063:Kif7 UTSW 7 79702278 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCTAAAAGTCTTGGAGTTCTTGG -3'
(R):5'- ACCTTGGGTAATGGCTGCAG -3'

Sequencing Primer
(F):5'- TGGAAATCCAGAGGATACAGCCC -3'
(R):5'- CTGCAGCTAGAGACAGGTAC -3'
Posted On2018-02-28