Incidental Mutation 'R6245:Cdon'
ID505533
Institutional Source Beutler Lab
Gene Symbol Cdon
Ensembl Gene ENSMUSG00000038119
Gene Namecell adhesion molecule-related/down-regulated by oncogenes
SynonymsCDO, CAM-related/down-regulated by oncogenes
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.530) question?
Stock #R6245 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location35421128-35507652 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35476939 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 737 (W737R)
Ref Sequence ENSEMBL: ENSMUSP00000113977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042842] [ENSMUST00000119129]
Predicted Effect probably damaging
Transcript: ENSMUST00000042842
AA Change: W737R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045547
Gene: ENSMUSG00000038119
AA Change: W737R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGc2 40 103 1.35e-9 SMART
IG 125 212 7.25e-1 SMART
IGc2 233 296 1.38e-6 SMART
IGc2 323 386 4.62e-17 SMART
IGc2 416 506 5e-13 SMART
FN3 573 660 2.18e-2 SMART
FN3 717 800 1.89e-11 SMART
FN3 822 909 7.01e-6 SMART
transmembrane domain 962 984 N/A INTRINSIC
low complexity region 1101 1111 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000084000
Predicted Effect probably damaging
Transcript: ENSMUST00000119129
AA Change: W737R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113977
Gene: ENSMUSG00000038119
AA Change: W737R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGc2 40 103 1.35e-9 SMART
IG 125 212 7.25e-1 SMART
IGc2 233 296 1.38e-6 SMART
IGc2 323 386 4.62e-17 SMART
IGc2 416 506 5e-13 SMART
FN3 573 660 2.18e-2 SMART
FN3 717 800 1.89e-11 SMART
FN3 822 909 7.01e-6 SMART
transmembrane domain 962 984 N/A INTRINSIC
low complexity region 1101 1111 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell surface receptor that is a member of the immunoglobulin superfamily. The encoded protein contains three fibronectin type III domains and five immunoglobulin-like C2-type domains. This protein is a member of a cell-surface receptor complex that mediates cell-cell interactions between muscle precursor cells and positively regulates myogenesis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice display facial defects characteristic of microform holoprosencephaly, are runted, and are prone to death prior to weaning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,178,418 Y218H probably benign Het
Abca9 A G 11: 110,135,423 I937T probably damaging Het
Adgrl3 T A 5: 81,688,556 N720K probably benign Het
Akr1c21 T G 13: 4,575,232 V54G possibly damaging Het
Alpi G T 1: 87,100,834 D111E probably damaging Het
Armc3 C T 2: 19,248,705 T219M probably damaging Het
Bms1 T A 6: 118,396,836 E780V probably damaging Het
Ccdc159 T C 9: 21,935,568 S244P probably damaging Het
Chdh T A 14: 30,035,305 V395D probably damaging Het
Col22a1 C A 15: 71,973,816 D366Y probably damaging Het
Crnkl1 T A 2: 145,928,131 N264I probably benign Het
Ctnnd2 T C 15: 30,905,748 L847P probably damaging Het
Cyp4a31 A C 4: 115,571,348 T382P possibly damaging Het
Dcaf8 A T 1: 172,165,867 M1L probably benign Het
Ddx31 T A 2: 28,844,982 F52I probably benign Het
Eps15 G A 4: 109,382,866 S852N possibly damaging Het
Fchsd1 A T 18: 37,962,775 L552Q probably damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Frem2 T C 3: 53,655,824 M421V probably benign Het
Gm1110 T G 9: 26,920,747 H36P probably benign Het
Gm11639 A T 11: 104,785,008 Y1542F probably benign Het
Hadha C T 5: 30,120,044 probably null Het
Hspa4 C T 11: 53,262,939 E702K probably benign Het
Intu C A 3: 40,675,326 T362K probably damaging Het
Jaml C T 9: 45,097,919 T248I probably damaging Het
Kcnj1 A T 9: 32,396,867 S176C probably damaging Het
Kcnj9 A G 1: 172,326,137 L140P probably damaging Het
Kif7 T C 7: 79,702,143 K957R probably damaging Het
Klc4 T A 17: 46,636,679 I366F probably damaging Het
Lamb2 A G 9: 108,488,199 probably null Het
Madd T C 2: 91,178,104 D151G probably benign Het
Man2a1 C A 17: 64,710,826 A689E probably damaging Het
Mapk8ip1 C A 2: 92,389,244 G81C probably damaging Het
Msmp T C 4: 43,583,909 Y48C probably damaging Het
Muc6 T C 7: 141,648,821 N567S probably damaging Het
Nrap A G 19: 56,354,221 Y748H probably damaging Het
Nrap C T 19: 56,379,875 A192T possibly damaging Het
Olfr1138 G C 2: 87,737,896 Q143E possibly damaging Het
Olfr1370 T A 13: 21,072,690 T204S possibly damaging Het
Olfr1384 T A 11: 49,514,165 F176I possibly damaging Het
Pcdhb8 T G 18: 37,357,169 D633E possibly damaging Het
Pcdhb9 G A 18: 37,403,154 V734M probably damaging Het
Plscr1 T C 9: 92,259,321 Y21H unknown Het
Ptk2b G T 14: 66,163,066 P767T probably damaging Het
Ptprz1 T C 6: 23,051,990 Y1424H probably damaging Het
Sec31a T A 5: 100,386,184 Q118L probably benign Het
Selenop A G 15: 3,274,734 S21G probably damaging Het
Shank1 G A 7: 44,352,253 S1132N unknown Het
Slf1 A G 13: 77,084,383 L534P probably damaging Het
Sparcl1 T A 5: 104,085,147 H596L probably damaging Het
Spocd1 C T 4: 129,957,108 probably null Het
Tbc1d24 A T 17: 24,185,993 I59N probably damaging Het
Tctex1d1 A G 4: 102,988,667 N32S probably benign Het
Tjp3 G A 10: 81,277,276 T580I probably benign Het
Tmem154 C T 3: 84,684,296 T51M possibly damaging Het
Tmem8b G A 4: 43,690,246 V894I probably benign Het
Trbv20 A T 6: 41,188,906 L88F possibly damaging Het
Tssk2 A C 16: 17,898,948 I72L possibly damaging Het
Tub T A 7: 109,027,058 I267N probably damaging Het
Vmn2r104 A T 17: 20,041,567 F434I possibly damaging Het
Vmn2r42 T C 7: 8,192,734 N471S probably damaging Het
Vmn2r94 C G 17: 18,258,123 G121R probably damaging Het
Wdr72 T C 9: 74,148,223 S245P probably damaging Het
Zbtb42 A G 12: 112,679,535 Y48C probably damaging Het
Zdbf2 T C 1: 63,304,433 V657A possibly damaging Het
Zfp768 A T 7: 127,344,091 C288* probably null Het
Zfp988 T A 4: 147,332,013 C301* probably null Het
Other mutations in Cdon
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00832:Cdon APN 9 35478116 missense probably damaging 1.00
IGL01307:Cdon APN 9 35457564 missense probably benign 0.01
IGL01528:Cdon APN 9 35470107 missense possibly damaging 0.95
IGL01663:Cdon APN 9 35483214 missense possibly damaging 0.57
IGL01723:Cdon APN 9 35503338 missense probably benign 0.05
IGL02200:Cdon APN 9 35483109 missense probably benign 0.28
IGL02444:Cdon APN 9 35473448 missense probably benign 0.09
IGL02547:Cdon APN 9 35478654 missense probably damaging 1.00
IGL02620:Cdon APN 9 35452799 missense probably benign 0.00
IGL02861:Cdon APN 9 35486957 missense probably damaging 0.96
IGL02894:Cdon APN 9 35455426 missense probably benign 0.01
IGL03153:Cdon APN 9 35477959 missense probably damaging 1.00
IGL03206:Cdon APN 9 35503306 missense probably benign
IGL03374:Cdon APN 9 35478003 missense possibly damaging 0.46
indentured UTSW 9 35452106 start codon destroyed probably null 1.00
Molar UTSW 9 35463895 missense probably benign 0.15
Servitude UTSW 9 35476948 missense probably damaging 1.00
PIT4280001:Cdon UTSW 9 35486935 missense probably damaging 1.00
R0045:Cdon UTSW 9 35486807 missense probably benign
R0045:Cdon UTSW 9 35486807 missense probably benign
R0064:Cdon UTSW 9 35489227 missense probably benign 0.03
R0396:Cdon UTSW 9 35470130 missense probably damaging 1.00
R0403:Cdon UTSW 9 35473500 missense probably benign 0.00
R0490:Cdon UTSW 9 35452682 missense probably damaging 1.00
R0547:Cdon UTSW 9 35457498 missense possibly damaging 0.88
R0609:Cdon UTSW 9 35478611 missense probably damaging 1.00
R0645:Cdon UTSW 9 35477083 splice site probably null
R0781:Cdon UTSW 9 35456437 splice site probably benign
R1110:Cdon UTSW 9 35456437 splice site probably benign
R1391:Cdon UTSW 9 35504189 missense possibly damaging 0.51
R1574:Cdon UTSW 9 35452937 splice site probably benign
R1851:Cdon UTSW 9 35483158 missense probably damaging 1.00
R2031:Cdon UTSW 9 35504074 missense probably damaging 0.96
R2230:Cdon UTSW 9 35491926 critical splice donor site probably null
R3683:Cdon UTSW 9 35489032 missense possibly damaging 0.89
R3684:Cdon UTSW 9 35489032 missense possibly damaging 0.89
R3685:Cdon UTSW 9 35489032 missense possibly damaging 0.89
R3941:Cdon UTSW 9 35464171 missense probably benign 0.09
R4030:Cdon UTSW 9 35491906 missense probably damaging 1.00
R4084:Cdon UTSW 9 35478131 missense probably damaging 0.98
R4462:Cdon UTSW 9 35457580 missense probably damaging 0.97
R4569:Cdon UTSW 9 35476969 missense probably damaging 1.00
R4677:Cdon UTSW 9 35478605 missense probably damaging 1.00
R4869:Cdon UTSW 9 35452904 missense possibly damaging 0.71
R5032:Cdon UTSW 9 35489034 missense probably damaging 1.00
R5047:Cdon UTSW 9 35478639 missense probably damaging 1.00
R5214:Cdon UTSW 9 35483208 missense probably damaging 1.00
R5341:Cdon UTSW 9 35470135 missense probably damaging 1.00
R5410:Cdon UTSW 9 35470035 missense probably damaging 0.99
R5581:Cdon UTSW 9 35504081 missense probably benign 0.01
R5696:Cdon UTSW 9 35491866 missense possibly damaging 0.69
R5757:Cdon UTSW 9 35452772 missense probably damaging 0.98
R5802:Cdon UTSW 9 35454420 missense probably damaging 0.99
R5845:Cdon UTSW 9 35457466 missense probably damaging 1.00
R5949:Cdon UTSW 9 35486951 missense probably benign 0.32
R6106:Cdon UTSW 9 35455408 nonsense probably null
R6845:Cdon UTSW 9 35486956 nonsense probably null
R6896:Cdon UTSW 9 35452106 start codon destroyed probably null 1.00
R7060:Cdon UTSW 9 35486909 missense probably damaging 1.00
R7076:Cdon UTSW 9 35504150 missense probably benign 0.00
R7184:Cdon UTSW 9 35463895 missense probably benign 0.15
R7382:Cdon UTSW 9 35478648 missense probably damaging 1.00
R7763:Cdon UTSW 9 35454415 nonsense probably null
R7857:Cdon UTSW 9 35456612 missense possibly damaging 0.79
R7885:Cdon UTSW 9 35456522 missense probably benign 0.01
R7894:Cdon UTSW 9 35476948 missense probably damaging 1.00
R7984:Cdon UTSW 9 35503302 missense probably benign 0.00
R8287:Cdon UTSW 9 35463929 missense probably benign
R8428:Cdon UTSW 9 35491867 missense probably benign 0.21
Z1177:Cdon UTSW 9 35491900 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGCCTTTTAACACCAGGTC -3'
(R):5'- TACTGTGCATGAATGGGTAGAG -3'

Sequencing Primer
(F):5'- GTCTGGAATTACCTACCCCTCAGAG -3'
(R):5'- GCATGAATGGGTAGAGTTGATATAAC -3'
Posted On2018-02-28