Incidental Mutation 'R6245:Jaml'
ID505534
Institutional Source Beutler Lab
Gene Symbol Jaml
Ensembl Gene ENSMUSG00000048534
Gene Namejunction adhesion molecule like
SynonymsLOC270152, Amica1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R6245 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location45079183-45108534 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 45097919 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 248 (T248I)
Ref Sequence ENSEMBL: ENSMUSP00000150697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050020] [ENSMUST00000215880] [ENSMUST00000216426]
Predicted Effect probably damaging
Transcript: ENSMUST00000050020
AA Change: T248I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052033
Gene: ENSMUSG00000048534
AA Change: T248I

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 30 139 5.7e-8 SMART
IG 143 254 9.26e-8 SMART
low complexity region 293 304 N/A INTRINSIC
low complexity region 309 320 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000215880
AA Change: T248I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216333
Predicted Effect probably benign
Transcript: ENSMUST00000216426
Predicted Effect probably benign
Transcript: ENSMUST00000217074
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,178,418 Y218H probably benign Het
Abca9 A G 11: 110,135,423 I937T probably damaging Het
Adgrl3 T A 5: 81,688,556 N720K probably benign Het
Akr1c21 T G 13: 4,575,232 V54G possibly damaging Het
Alpi G T 1: 87,100,834 D111E probably damaging Het
Armc3 C T 2: 19,248,705 T219M probably damaging Het
Bms1 T A 6: 118,396,836 E780V probably damaging Het
Ccdc159 T C 9: 21,935,568 S244P probably damaging Het
Cdon T C 9: 35,476,939 W737R probably damaging Het
Chdh T A 14: 30,035,305 V395D probably damaging Het
Col22a1 C A 15: 71,973,816 D366Y probably damaging Het
Crnkl1 T A 2: 145,928,131 N264I probably benign Het
Ctnnd2 T C 15: 30,905,748 L847P probably damaging Het
Cyp4a31 A C 4: 115,571,348 T382P possibly damaging Het
Dcaf8 A T 1: 172,165,867 M1L probably benign Het
Ddx31 T A 2: 28,844,982 F52I probably benign Het
Eps15 G A 4: 109,382,866 S852N possibly damaging Het
Fchsd1 A T 18: 37,962,775 L552Q probably damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Frem2 T C 3: 53,655,824 M421V probably benign Het
Gm1110 T G 9: 26,920,747 H36P probably benign Het
Gm11639 A T 11: 104,785,008 Y1542F probably benign Het
Hadha C T 5: 30,120,044 probably null Het
Hspa4 C T 11: 53,262,939 E702K probably benign Het
Intu C A 3: 40,675,326 T362K probably damaging Het
Kcnj1 A T 9: 32,396,867 S176C probably damaging Het
Kcnj9 A G 1: 172,326,137 L140P probably damaging Het
Kif7 T C 7: 79,702,143 K957R probably damaging Het
Klc4 T A 17: 46,636,679 I366F probably damaging Het
Lamb2 A G 9: 108,488,199 probably null Het
Madd T C 2: 91,178,104 D151G probably benign Het
Man2a1 C A 17: 64,710,826 A689E probably damaging Het
Mapk8ip1 C A 2: 92,389,244 G81C probably damaging Het
Msmp T C 4: 43,583,909 Y48C probably damaging Het
Muc6 T C 7: 141,648,821 N567S probably damaging Het
Nrap A G 19: 56,354,221 Y748H probably damaging Het
Nrap C T 19: 56,379,875 A192T possibly damaging Het
Olfr1138 G C 2: 87,737,896 Q143E possibly damaging Het
Olfr1370 T A 13: 21,072,690 T204S possibly damaging Het
Olfr1384 T A 11: 49,514,165 F176I possibly damaging Het
Pcdhb8 T G 18: 37,357,169 D633E possibly damaging Het
Pcdhb9 G A 18: 37,403,154 V734M probably damaging Het
Plscr1 T C 9: 92,259,321 Y21H unknown Het
Ptk2b G T 14: 66,163,066 P767T probably damaging Het
Ptprz1 T C 6: 23,051,990 Y1424H probably damaging Het
Sec31a T A 5: 100,386,184 Q118L probably benign Het
Selenop A G 15: 3,274,734 S21G probably damaging Het
Shank1 G A 7: 44,352,253 S1132N unknown Het
Slf1 A G 13: 77,084,383 L534P probably damaging Het
Sparcl1 T A 5: 104,085,147 H596L probably damaging Het
Spocd1 C T 4: 129,957,108 probably null Het
Tbc1d24 A T 17: 24,185,993 I59N probably damaging Het
Tctex1d1 A G 4: 102,988,667 N32S probably benign Het
Tjp3 G A 10: 81,277,276 T580I probably benign Het
Tmem154 C T 3: 84,684,296 T51M possibly damaging Het
Tmem8b G A 4: 43,690,246 V894I probably benign Het
Trbv20 A T 6: 41,188,906 L88F possibly damaging Het
Tssk2 A C 16: 17,898,948 I72L possibly damaging Het
Tub T A 7: 109,027,058 I267N probably damaging Het
Vmn2r104 A T 17: 20,041,567 F434I possibly damaging Het
Vmn2r42 T C 7: 8,192,734 N471S probably damaging Het
Vmn2r94 C G 17: 18,258,123 G121R probably damaging Het
Wdr72 T C 9: 74,148,223 S245P probably damaging Het
Zbtb42 A G 12: 112,679,535 Y48C probably damaging Het
Zdbf2 T C 1: 63,304,433 V657A possibly damaging Het
Zfp768 A T 7: 127,344,091 C288* probably null Het
Zfp988 T A 4: 147,332,013 C301* probably null Het
Other mutations in Jaml
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Jaml APN 9 45100989 unclassified probably benign
IGL00771:Jaml APN 9 45093807 missense possibly damaging 0.94
IGL01139:Jaml APN 9 45101019 missense possibly damaging 0.91
IGL02669:Jaml APN 9 45104191 missense possibly damaging 0.68
IGL03405:Jaml APN 9 45093809 missense possibly damaging 0.61
R0207:Jaml UTSW 9 45093767 missense probably benign 0.01
R1962:Jaml UTSW 9 45104197 missense possibly damaging 0.80
R2119:Jaml UTSW 9 45101064 missense probably damaging 1.00
R2120:Jaml UTSW 9 45101064 missense probably damaging 1.00
R2124:Jaml UTSW 9 45101064 missense probably damaging 1.00
R2358:Jaml UTSW 9 45101063 missense possibly damaging 0.95
R3917:Jaml UTSW 9 45101151 unclassified probably benign
R4801:Jaml UTSW 9 45101064 missense possibly damaging 0.57
R4802:Jaml UTSW 9 45101064 missense possibly damaging 0.57
R5224:Jaml UTSW 9 45104266 missense probably damaging 1.00
R5739:Jaml UTSW 9 45088728 missense probably damaging 1.00
R5760:Jaml UTSW 9 45097754 missense probably benign 0.02
R6033:Jaml UTSW 9 45088710 missense probably damaging 1.00
R6033:Jaml UTSW 9 45088710 missense probably damaging 1.00
R6174:Jaml UTSW 9 45088773 missense probably damaging 1.00
R6753:Jaml UTSW 9 45107379 missense probably benign 0.43
R6797:Jaml UTSW 9 45088760 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGCTATGACTCCAACATGCG -3'
(R):5'- GTACAAGTCCAAGGTCAGCC -3'

Sequencing Primer
(F):5'- TGACTCCAACATGCGTAGTG -3'
(R):5'- AGAAGCAGTGCCTCCTTCC -3'
Posted On2018-02-28