Incidental Mutation 'R6245:Hspa4'
ID505540
Institutional Source Beutler Lab
Gene Symbol Hspa4
Ensembl Gene ENSMUSG00000020361
Gene Nameheat shock protein 4
Synonyms70kDa, Hsp70RY, Hsp110, APG-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.884) question?
Stock #R6245 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location53259814-53300457 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 53262939 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 702 (E702K)
Ref Sequence ENSEMBL: ENSMUSP00000020630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020630]
Predicted Effect probably benign
Transcript: ENSMUST00000020630
AA Change: E702K

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000020630
Gene: ENSMUSG00000020361
AA Change: E702K

DomainStartEndE-ValueType
Pfam:HSP70 3 608 2.9e-211 PFAM
Pfam:HSP70 590 693 3.8e-10 PFAM
low complexity region 787 800 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139322
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151854
Meta Mutation Damage Score 0.5176 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit age-dependent neurofibrillary tangles and tau deposits, impaired contextual conditioning, and impaired bar grasping. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,178,418 Y218H probably benign Het
Abca9 A G 11: 110,135,423 I937T probably damaging Het
Adgrl3 T A 5: 81,688,556 N720K probably benign Het
Akr1c21 T G 13: 4,575,232 V54G possibly damaging Het
Alpi G T 1: 87,100,834 D111E probably damaging Het
Armc3 C T 2: 19,248,705 T219M probably damaging Het
Bms1 T A 6: 118,396,836 E780V probably damaging Het
Ccdc159 T C 9: 21,935,568 S244P probably damaging Het
Cdon T C 9: 35,476,939 W737R probably damaging Het
Chdh T A 14: 30,035,305 V395D probably damaging Het
Col22a1 C A 15: 71,973,816 D366Y probably damaging Het
Crnkl1 T A 2: 145,928,131 N264I probably benign Het
Ctnnd2 T C 15: 30,905,748 L847P probably damaging Het
Cyp4a31 A C 4: 115,571,348 T382P possibly damaging Het
Dcaf8 A T 1: 172,165,867 M1L probably benign Het
Ddx31 T A 2: 28,844,982 F52I probably benign Het
Eps15 G A 4: 109,382,866 S852N possibly damaging Het
Fchsd1 A T 18: 37,962,775 L552Q probably damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Frem2 T C 3: 53,655,824 M421V probably benign Het
Gm1110 T G 9: 26,920,747 H36P probably benign Het
Gm11639 A T 11: 104,785,008 Y1542F probably benign Het
Hadha C T 5: 30,120,044 probably null Het
Intu C A 3: 40,675,326 T362K probably damaging Het
Jaml C T 9: 45,097,919 T248I probably damaging Het
Kcnj1 A T 9: 32,396,867 S176C probably damaging Het
Kcnj9 A G 1: 172,326,137 L140P probably damaging Het
Kif7 T C 7: 79,702,143 K957R probably damaging Het
Klc4 T A 17: 46,636,679 I366F probably damaging Het
Lamb2 A G 9: 108,488,199 probably null Het
Madd T C 2: 91,178,104 D151G probably benign Het
Man2a1 C A 17: 64,710,826 A689E probably damaging Het
Mapk8ip1 C A 2: 92,389,244 G81C probably damaging Het
Msmp T C 4: 43,583,909 Y48C probably damaging Het
Muc6 T C 7: 141,648,821 N567S probably damaging Het
Nrap A G 19: 56,354,221 Y748H probably damaging Het
Nrap C T 19: 56,379,875 A192T possibly damaging Het
Olfr1138 G C 2: 87,737,896 Q143E possibly damaging Het
Olfr1370 T A 13: 21,072,690 T204S possibly damaging Het
Olfr1384 T A 11: 49,514,165 F176I possibly damaging Het
Pcdhb8 T G 18: 37,357,169 D633E possibly damaging Het
Pcdhb9 G A 18: 37,403,154 V734M probably damaging Het
Plscr1 T C 9: 92,259,321 Y21H unknown Het
Ptk2b G T 14: 66,163,066 P767T probably damaging Het
Ptprz1 T C 6: 23,051,990 Y1424H probably damaging Het
Sec31a T A 5: 100,386,184 Q118L probably benign Het
Selenop A G 15: 3,274,734 S21G probably damaging Het
Shank1 G A 7: 44,352,253 S1132N unknown Het
Slf1 A G 13: 77,084,383 L534P probably damaging Het
Sparcl1 T A 5: 104,085,147 H596L probably damaging Het
Spocd1 C T 4: 129,957,108 probably null Het
Tbc1d24 A T 17: 24,185,993 I59N probably damaging Het
Tctex1d1 A G 4: 102,988,667 N32S probably benign Het
Tjp3 G A 10: 81,277,276 T580I probably benign Het
Tmem154 C T 3: 84,684,296 T51M possibly damaging Het
Tmem8b G A 4: 43,690,246 V894I probably benign Het
Trbv20 A T 6: 41,188,906 L88F possibly damaging Het
Tssk2 A C 16: 17,898,948 I72L possibly damaging Het
Tub T A 7: 109,027,058 I267N probably damaging Het
Vmn2r104 A T 17: 20,041,567 F434I possibly damaging Het
Vmn2r42 T C 7: 8,192,734 N471S probably damaging Het
Vmn2r94 C G 17: 18,258,123 G121R probably damaging Het
Wdr72 T C 9: 74,148,223 S245P probably damaging Het
Zbtb42 A G 12: 112,679,535 Y48C probably damaging Het
Zdbf2 T C 1: 63,304,433 V657A possibly damaging Het
Zfp768 A T 7: 127,344,091 C288* probably null Het
Zfp988 T A 4: 147,332,013 C301* probably null Het
Other mutations in Hspa4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Hspa4 APN 11 53280717 splice site probably null
IGL00701:Hspa4 APN 11 53271033 missense possibly damaging 0.89
IGL00957:Hspa4 APN 11 53280687 missense probably benign 0.00
IGL02324:Hspa4 APN 11 53300058 critical splice donor site probably null
IGL02328:Hspa4 APN 11 53300058 critical splice donor site probably null
IGL02336:Hspa4 APN 11 53262373 missense probably benign 0.00
IGL02441:Hspa4 APN 11 53270982 missense probably benign 0.03
IGL03323:Hspa4 APN 11 53265133 missense probably benign 0.05
IGL03356:Hspa4 APN 11 53269800 missense probably damaging 1.00
R0027:Hspa4 UTSW 11 53283585 missense probably benign 0.00
R0398:Hspa4 UTSW 11 53272879 critical splice acceptor site probably null
R0568:Hspa4 UTSW 11 53262876 splice site probably benign
R0655:Hspa4 UTSW 11 53269692 missense probably benign 0.02
R1876:Hspa4 UTSW 11 53284156 missense probably benign 0.16
R2225:Hspa4 UTSW 11 53286933 missense probably benign 0.28
R3813:Hspa4 UTSW 11 53270979 missense probably benign 0.21
R3937:Hspa4 UTSW 11 53270949 missense probably benign 0.13
R4360:Hspa4 UTSW 11 53265092 missense probably damaging 1.00
R4457:Hspa4 UTSW 11 53280568 missense probably damaging 1.00
R4492:Hspa4 UTSW 11 53280469 missense probably damaging 1.00
R4751:Hspa4 UTSW 11 53284199 missense probably benign 0.22
R5032:Hspa4 UTSW 11 53289123 missense possibly damaging 0.89
R5233:Hspa4 UTSW 11 53286975 missense possibly damaging 0.46
R5320:Hspa4 UTSW 11 53262983 missense probably damaging 1.00
R5650:Hspa4 UTSW 11 53265092 missense probably damaging 1.00
R6108:Hspa4 UTSW 11 53261712 missense probably damaging 0.97
R6211:Hspa4 UTSW 11 53262939 missense probably benign 0.06
R6232:Hspa4 UTSW 11 53262939 missense probably benign 0.06
R6234:Hspa4 UTSW 11 53262939 missense probably benign 0.06
R6235:Hspa4 UTSW 11 53262939 missense probably benign 0.06
R6243:Hspa4 UTSW 11 53262939 missense probably benign 0.06
R6468:Hspa4 UTSW 11 53265056 missense probably benign 0.03
R7194:Hspa4 UTSW 11 53265938 missense probably damaging 1.00
R7308:Hspa4 UTSW 11 53267103 missense possibly damaging 0.70
R7654:Hspa4 UTSW 11 53300124 missense probably damaging 0.98
R7731:Hspa4 UTSW 11 53266964 critical splice donor site probably null
R7813:Hspa4 UTSW 11 53272036 missense probably damaging 1.00
R7841:Hspa4 UTSW 11 53267060 missense possibly damaging 0.95
R7849:Hspa4 UTSW 11 53280703 missense possibly damaging 0.88
R7913:Hspa4 UTSW 11 53262307 missense probably benign 0.01
R7980:Hspa4 UTSW 11 53280577 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- TGGAAGATGAGCAACTCCCTAC -3'
(R):5'- TGTGCGCATACACATACCC -3'

Sequencing Primer
(F):5'- GGACTTCTGTGAGTTCAAAGACACC -3'
(R):5'- GCATACACATACCCAGAGAGTG -3'
Posted On2018-02-28