Mutagenetix > Incidental Mutation

Incidental Mutation 'R6245:Abca9'

505542

Institutional Source

Beutler Lab

Gene Symbol

Abca9

Ensembl Gene

ENSMUSG00000041797

Gene Name

ATP-binding cassette, sub-family A (ABC1), member 9

Synonyms

D630040K07Rik

MMRRC Submission

Accession Numbers

NCBI RefSeq: NM_147220.2; MGI: 2386796

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6245 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

110100749-110168196 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 110135423 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 937 (I937T)

Ref Sequence

ENSEMBL: ENSMUSP00000036338 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044850]

AlphaFold

Q8K449

Predicted Effect

probably damaging
Transcript: ENSMUST00000044850
AA Change: I937T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000036338
Gene: ENSMUSG00000041797
AA Change: I937T

Domain	Start	End	E-Value	Type
Pfam:ABC2_membrane_3	28	419	2.7e-31	PFAM
AAA	509	693	9.28e-12	SMART
low complexity region	817	837	N/A	INTRINSIC
transmembrane domain	862	884	N/A	INTRINSIC
Pfam:ABC2_membrane_3	918	1219	5.2e-15	PFAM
low complexity region	1250	1259	N/A	INTRINSIC
AAA	1317	1497	8.47e-6	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the superfamily of ATP-binding cassette (ABC) transporters and the encoded protein contains two transmembrane domains and two nucleotide binding folds. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This gene is a member of the ABC1 subfamily and is clustered with four other ABC1 family members on chromosome 17q24. Transcriptional expression of this gene is induced during monocyte differentiation into macrophages and is suppressed by cholesterol import. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	C	15: 8,178,418	Y218H	probably benign	Het
Adgrl3	T	A	5: 81,688,556	N720K	probably benign	Het
Akr1c21	T	G	13: 4,575,232	V54G	possibly damaging	Het
Alpi	G	T	1: 87,100,834	D111E	probably damaging	Het
Armc3	C	T	2: 19,248,705	T219M	probably damaging	Het
Bms1	T	A	6: 118,396,836	E780V	probably damaging	Het
Ccdc159	T	C	9: 21,935,568	S244P	probably damaging	Het
Cdon	T	C	9: 35,476,939	W737R	probably damaging	Het
Chdh	T	A	14: 30,035,305	V395D	probably damaging	Het
Col22a1	C	A	15: 71,973,816	D366Y	probably damaging	Het
Crnkl1	T	A	2: 145,928,131	N264I	probably benign	Het
Ctnnd2	T	C	15: 30,905,748	L847P	probably damaging	Het
Cyp4a31	A	C	4: 115,571,348	T382P	possibly damaging	Het
Dcaf8	A	T	1: 172,165,867	M1L	probably benign	Het
Ddx31	T	A	2: 28,844,982	F52I	probably benign	Het
Eps15	G	A	4: 109,382,866	S852N	possibly damaging	Het
Fchsd1	A	T	18: 37,962,775	L552Q	probably damaging	Het
Fetub	C	T	16: 22,932,331	R143C	probably damaging	Het
Frem2	T	C	3: 53,655,824	M421V	probably benign	Het
Gm1110	T	G	9: 26,920,747	H36P	probably benign	Het
Gm11639	A	T	11: 104,785,008	Y1542F	probably benign	Het
Hadha	C	T	5: 30,120,044		probably null	Het
Hspa4	C	T	11: 53,262,939	E702K	probably benign	Het
Intu	C	A	3: 40,675,326	T362K	probably damaging	Het
Jaml	C	T	9: 45,097,919	T248I	probably damaging	Het
Kcnj1	A	T	9: 32,396,867	S176C	probably damaging	Het
Kcnj9	A	G	1: 172,326,137	L140P	probably damaging	Het
Kif7	T	C	7: 79,702,143	K957R	probably damaging	Het
Klc4	T	A	17: 46,636,679	I366F	probably damaging	Het
Lamb2	A	G	9: 108,488,199		probably null	Het
Madd	T	C	2: 91,178,104	D151G	probably benign	Het
Man2a1	C	A	17: 64,710,826	A689E	probably damaging	Het
Mapk8ip1	C	A	2: 92,389,244	G81C	probably damaging	Het
Msmp	T	C	4: 43,583,909	Y48C	probably damaging	Het
Muc6	T	C	7: 141,648,821	N567S	probably damaging	Het
Nrap	A	G	19: 56,354,221	Y748H	probably damaging	Het
Nrap	C	T	19: 56,379,875	A192T	possibly damaging	Het
Olfr1138	G	C	2: 87,737,896	Q143E	possibly damaging	Het
Olfr1370	T	A	13: 21,072,690	T204S	possibly damaging	Het
Olfr1384	T	A	11: 49,514,165	F176I	possibly damaging	Het
Pcdhb8	T	G	18: 37,357,169	D633E	possibly damaging	Het
Pcdhb9	G	A	18: 37,403,154	V734M	probably damaging	Het
Plscr1	T	C	9: 92,259,321	Y21H	unknown	Het
Ptk2b	G	T	14: 66,163,066	P767T	probably damaging	Het
Ptprz1	T	C	6: 23,051,990	Y1424H	probably damaging	Het
Sec31a	T	A	5: 100,386,184	Q118L	probably benign	Het
Selenop	A	G	15: 3,274,734	S21G	probably damaging	Het
Shank1	G	A	7: 44,352,253	S1132N	unknown	Het
Slf1	A	G	13: 77,084,383	L534P	probably damaging	Het
Sparcl1	T	A	5: 104,085,147	H596L	probably damaging	Het
Spocd1	C	T	4: 129,957,108		probably null	Het
Tbc1d24	A	T	17: 24,185,993	I59N	probably damaging	Het
Tctex1d1	A	G	4: 102,988,667	N32S	probably benign	Het
Tjp3	G	A	10: 81,277,276	T580I	probably benign	Het
Tmem154	C	T	3: 84,684,296	T51M	possibly damaging	Het
Tmem8b	G	A	4: 43,690,246	V894I	probably benign	Het
Trbv20	A	T	6: 41,188,906	L88F	possibly damaging	Het
Tssk2	A	C	16: 17,898,948	I72L	possibly damaging	Het
Tub	T	A	7: 109,027,058	I267N	probably damaging	Het
Vmn2r104	A	T	17: 20,041,567	F434I	possibly damaging	Het
Vmn2r42	T	C	7: 8,192,734	N471S	probably damaging	Het
Vmn2r94	C	G	17: 18,258,123	G121R	probably damaging	Het
Wdr72	T	C	9: 74,148,223	S245P	probably damaging	Het
Zbtb42	A	G	12: 112,679,535	Y48C	probably damaging	Het
Zdbf2	T	C	1: 63,304,433	V657A	possibly damaging	Het
Zfp768	A	T	7: 127,344,091	C288*	probably null	Het
Zfp988	T	A	4: 147,332,013	C301*	probably null	Het

Other mutations in Abca9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00309:Abca9	APN	11	110160516	missense	probably benign
IGL00467:Abca9	APN	11	110145670	splice site	probably benign
IGL00886:Abca9	APN	11	110163275	missense	possibly damaging	0.93
IGL01340:Abca9	APN	11	110130627	missense	probably benign
IGL01351:Abca9	APN	11	110148903	missense	probably damaging	0.99
IGL01383:Abca9	APN	11	110113293	splice site	probably benign
IGL01384:Abca9	APN	11	110145637	missense	probably damaging	1.00
IGL01482:Abca9	APN	11	110120773	missense	probably benign	0.05
IGL01586:Abca9	APN	11	110154417	missense	probably damaging	0.99
IGL01589:Abca9	APN	11	110155177	missense	probably damaging	1.00
IGL01926:Abca9	APN	11	110135329	splice site	probably benign
IGL02059:Abca9	APN	11	110160394	splice site	probably benign
IGL02084:Abca9	APN	11	110130597	missense	probably benign
IGL02096:Abca9	APN	11	110102533	missense	probably damaging	1.00
IGL02096:Abca9	APN	11	110165980	missense	probably benign	0.01
IGL02290:Abca9	APN	11	110135351	missense	probably damaging	1.00
IGL02303:Abca9	APN	11	110154550	missense	probably damaging	1.00
IGL02549:Abca9	APN	11	110102053	missense	probably damaging	1.00
IGL02687:Abca9	APN	11	110114232	missense	probably damaging	1.00
IGL02752:Abca9	APN	11	110127368	missense	probably damaging	1.00
IGL02814:Abca9	APN	11	110154467	missense	possibly damaging	0.90
IGL02878:Abca9	APN	11	110138329	missense	probably benign	0.01
IGL03088:Abca9	APN	11	110144261	missense	probably benign	0.06
IGL03231:Abca9	APN	11	110155268	missense	probably damaging	0.96
R0050:Abca9	UTSW	11	110145591	missense	probably damaging	1.00
R0050:Abca9	UTSW	11	110145591	missense	probably damaging	1.00
R0064:Abca9	UTSW	11	110144871	missense	probably damaging	1.00
R0064:Abca9	UTSW	11	110144872	missense	probably damaging	1.00
R0068:Abca9	UTSW	11	110145579	missense	probably damaging	0.99
R0189:Abca9	UTSW	11	110108653	missense	probably damaging	1.00
R0189:Abca9	UTSW	11	110141662	splice site	probably benign
R0375:Abca9	UTSW	11	110115447	missense	probably benign	0.00
R0601:Abca9	UTSW	11	110117058	critical splice donor site	probably null
R0624:Abca9	UTSW	11	110139620	missense	probably damaging	1.00
R0652:Abca9	UTSW	11	110152063	missense	probably benign	0.02
R1004:Abca9	UTSW	11	110151954	missense	possibly damaging	0.88
R1222:Abca9	UTSW	11	110145064	splice site	probably benign
R1451:Abca9	UTSW	11	110127447	missense	probably damaging	1.00
R1462:Abca9	UTSW	11	110160516	missense	probably benign
R1462:Abca9	UTSW	11	110160516	missense	probably benign
R1474:Abca9	UTSW	11	110145579	missense	probably damaging	0.99
R1499:Abca9	UTSW	11	110139632	missense	probably benign	0.00
R1778:Abca9	UTSW	11	110130716	nonsense	probably null
R2015:Abca9	UTSW	11	110131846	missense	probably benign	0.01
R2295:Abca9	UTSW	11	110148903	missense	probably damaging	0.99
R2303:Abca9	UTSW	11	110158226	missense	probably benign	0.01
R2403:Abca9	UTSW	11	110115454	missense	probably benign	0.16
R2886:Abca9	UTSW	11	110144886	splice site	probably benign
R3435:Abca9	UTSW	11	110154430	missense	probably benign	0.24
R3976:Abca9	UTSW	11	110148789	missense	probably benign	0.25
R4335:Abca9	UTSW	11	110152017	missense	probably damaging	1.00
R4411:Abca9	UTSW	11	110151955	missense	probably benign	0.00
R4613:Abca9	UTSW	11	110144784	missense	probably benign	0.26
R4690:Abca9	UTSW	11	110148880	missense	probably damaging	1.00
R4720:Abca9	UTSW	11	110127422	missense	probably damaging	1.00
R4751:Abca9	UTSW	11	110130570	missense	probably benign	0.00
R4797:Abca9	UTSW	11	110118119	missense	probably benign
R4818:Abca9	UTSW	11	110155154	critical splice donor site	probably null
R4903:Abca9	UTSW	11	110147001	missense	probably damaging	1.00
R4971:Abca9	UTSW	11	110152048	missense	probably benign	0.43
R4977:Abca9	UTSW	11	110136073	missense	probably benign	0.00
R5019:Abca9	UTSW	11	110165934	missense	probably benign
R5079:Abca9	UTSW	11	110145569	missense	possibly damaging	0.47
R5082:Abca9	UTSW	11	110131868	missense	probably benign
R5093:Abca9	UTSW	11	110141532	missense	probably damaging	0.98
R5212:Abca9	UTSW	11	110107226	missense	probably benign	0.02
R5350:Abca9	UTSW	11	110115538	missense	probably benign
R5368:Abca9	UTSW	11	110145546	missense	probably damaging	1.00
R5432:Abca9	UTSW	11	110141554	missense	possibly damaging	0.83
R5436:Abca9	UTSW	11	110134236	missense	probably damaging	1.00
R5497:Abca9	UTSW	11	110130692	missense	probably damaging	1.00
R5503:Abca9	UTSW	11	110141610	missense	probably damaging	1.00
R5594:Abca9	UTSW	11	110144862	missense	probably damaging	1.00
R5742:Abca9	UTSW	11	110160417	missense	probably damaging	0.98
R5776:Abca9	UTSW	11	110107460	splice site	probably null
R5781:Abca9	UTSW	11	110101987	missense	probably damaging	1.00
R5872:Abca9	UTSW	11	110117076	missense	possibly damaging	0.70
R5923:Abca9	UTSW	11	110160552	missense	probably benign	0.09
R6020:Abca9	UTSW	11	110145613	missense	possibly damaging	0.86
R6179:Abca9	UTSW	11	110134254	missense	probably benign	0.05
R6249:Abca9	UTSW	11	110145627	missense	probably benign
R6365:Abca9	UTSW	11	110145655	missense	possibly damaging	0.63
R6385:Abca9	UTSW	11	110134254	missense	probably damaging	0.99
R6481:Abca9	UTSW	11	110165962	nonsense	probably null
R6675:Abca9	UTSW	11	110115476	missense	probably benign
R6909:Abca9	UTSW	11	110115497	missense	probably benign	0.01
R7390:Abca9	UTSW	11	110145661	missense	probably benign	0.01
R7429:Abca9	UTSW	11	110127426	frame shift	probably null
R7431:Abca9	UTSW	11	110127426	frame shift	probably null
R7621:Abca9	UTSW	11	110160533	missense	probably benign	0.00
R7623:Abca9	UTSW	11	110107558	missense	probably benign	0.27
R7660:Abca9	UTSW	11	110115452	missense	probably benign
R7784:Abca9	UTSW	11	110154417	nonsense	probably null
R7798:Abca9	UTSW	11	110138179	missense	probably benign	0.45
R7839:Abca9	UTSW	11	110134259	missense	probably benign	0.43
R7891:Abca9	UTSW	11	110163272	missense	probably benign	0.03
R7894:Abca9	UTSW	11	110106589	missense	possibly damaging	0.49
R8030:Abca9	UTSW	11	110120708	missense	probably benign
R8133:Abca9	UTSW	11	110127463	missense	possibly damaging	0.88
R8195:Abca9	UTSW	11	110138329	missense	probably benign	0.01
R8304:Abca9	UTSW	11	110107128	critical splice donor site	probably null
R8386:Abca9	UTSW	11	110130692	missense	probably damaging	1.00
R8390:Abca9	UTSW	11	110145630	missense	probably benign	0.01
R8692:Abca9	UTSW	11	110141583	missense	probably benign	0.11
R8721:Abca9	UTSW	11	110144289	missense	possibly damaging	0.82
R8738:Abca9	UTSW	11	110165991	start codon destroyed	probably null	1.00
R8900:Abca9	UTSW	11	110154392	missense	probably benign
R8948:Abca9	UTSW	11	110163380	critical splice acceptor site	probably null
R8950:Abca9	UTSW	11	110163380	critical splice acceptor site	probably null
R8964:Abca9	UTSW	11	110147249	nonsense	probably null
R9019:Abca9	UTSW	11	110120696	missense
R9034:Abca9	UTSW	11	110148789	missense	probably benign	0.25
R9035:Abca9	UTSW	11	110130635	missense	probably damaging	0.97
R9086:Abca9	UTSW	11	110102053	missense	probably damaging	1.00
R9199:Abca9	UTSW	11	110165944	missense	possibly damaging	0.49
R9402:Abca9	UTSW	11	110158328	missense	probably benign	0.14
R9414:Abca9	UTSW	11	110144274	missense	probably damaging	0.97
R9554:Abca9	UTSW	11	110138281	missense	probably benign
R9626:Abca9	UTSW	11	110120780	missense	probably benign	0.01
R9651:Abca9	UTSW	11	110115493	missense	probably benign	0.09
R9665:Abca9	UTSW	11	110115454	missense	probably benign
R9665:Abca9	UTSW	11	110115455	missense	probably benign	0.00
R9731:Abca9	UTSW	11	110134198	missense	probably benign
Z1176:Abca9	UTSW	11	110135375	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- GCTCAGCTTCTCCTATGAAATGG -3'
(R):5'- TCTAACTCTGCCCTTTAAGGATATCTG -3'

Sequencing Primer
(F):5'- GGGAAATATATCACTTGCGTCATGTC -3'
(R):5'- CCCTTTAAGGATATCTGTAGGCAG -3'

Posted On

2018-02-28