Incidental Mutation 'R6245:Ptk2b'
ID505548
Institutional Source Beutler Lab
Gene Symbol Ptk2b
Ensembl Gene ENSMUSG00000059456
Gene NamePTK2 protein tyrosine kinase 2 beta
SynonymsCAKbeta, cellular adhesion kinase beta, E430023O05Rik, proline-rich tyrosine kinase 2, Raftk, related adhesion focal tyrosine kinase, PYK2, calcium-dependent tyrosine kinase
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.700) question?
Stock #R6245 (G1)
Quality Score85.0076
Status Not validated
Chromosome14
Chromosomal Location66153257-66281052 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 66163066 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 767 (P767T)
Ref Sequence ENSEMBL: ENSMUSP00000106750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022622] [ENSMUST00000089250] [ENSMUST00000111121] [ENSMUST00000178730]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022622
AA Change: P767T

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000022622
Gene: ENSMUSG00000059456
AA Change: P767T

DomainStartEndE-ValueType
B41 35 265 1.33e-45 SMART
TyrKc 425 679 1.46e-139 SMART
low complexity region 713 726 N/A INTRINSIC
Pfam:Focal_AT 870 1008 1.7e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000089250
SMART Domains Protein: ENSMUSP00000086661
Gene: ENSMUSG00000059456

DomainStartEndE-ValueType
B41 35 265 1.33e-45 SMART
TyrKc 425 679 1.46e-139 SMART
low complexity region 713 726 N/A INTRINSIC
Pfam:Focal_AT 828 966 2e-68 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111121
AA Change: P767T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106750
Gene: ENSMUSG00000059456
AA Change: P767T

DomainStartEndE-ValueType
B41 35 265 1.33e-45 SMART
TyrKc 425 679 1.46e-139 SMART
low complexity region 713 726 N/A INTRINSIC
Pfam:Focal_AT 866 1004 1.1e-67 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136216
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148104
Predicted Effect probably benign
Transcript: ENSMUST00000154865
SMART Domains Protein: ENSMUSP00000122683
Gene: ENSMUSG00000059456

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 83 8.5e-27 PFAM
low complexity region 117 130 N/A INTRINSIC
Pfam:Focal_AT 243 375 5e-57 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000178730
AA Change: P767T

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000137008
Gene: ENSMUSG00000059456
AA Change: P767T

DomainStartEndE-ValueType
B41 35 265 1.33e-45 SMART
TyrKc 425 679 1.46e-139 SMART
low complexity region 713 726 N/A INTRINSIC
Pfam:Focal_AT 870 1002 2.1e-55 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein tyrosine kinase which is involved in calcium-induced regulation of ion channels and activation of the map kinase signaling pathway. The encoded protein may represent an important signaling intermediate between neuropeptide-activated receptors or neurotransmitters that increase calcium flux and the downstream signals that regulate neuronal activity. The encoded protein undergoes rapid tyrosine phosphorylation and activation in response to increases in the intracellular calcium concentration, nicotinic acetylcholine receptor activation, membrane depolarization, or protein kinase C activation. This protein has been shown to bind CRK-associated substrate, nephrocystin, GTPase regulator associated with FAK, and the SH2 domain of GRB2. The encoded protein is a member of the FAK subfamily of protein tyrosine kinases but lacks significant sequence similarity to kinases from other subfamilies. Four transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show alterations in endothelial nitric oxide synthase-mediated vascular function and angiogenic responses. Mice homozygous for a second knock-out allele exhibit multiple defects in macrophage migration and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,178,418 Y218H probably benign Het
Abca9 A G 11: 110,135,423 I937T probably damaging Het
Adgrl3 T A 5: 81,688,556 N720K probably benign Het
Akr1c21 T G 13: 4,575,232 V54G possibly damaging Het
Alpi G T 1: 87,100,834 D111E probably damaging Het
Armc3 C T 2: 19,248,705 T219M probably damaging Het
Bms1 T A 6: 118,396,836 E780V probably damaging Het
Ccdc159 T C 9: 21,935,568 S244P probably damaging Het
Cdon T C 9: 35,476,939 W737R probably damaging Het
Chdh T A 14: 30,035,305 V395D probably damaging Het
Col22a1 C A 15: 71,973,816 D366Y probably damaging Het
Crnkl1 T A 2: 145,928,131 N264I probably benign Het
Ctnnd2 T C 15: 30,905,748 L847P probably damaging Het
Cyp4a31 A C 4: 115,571,348 T382P possibly damaging Het
Dcaf8 A T 1: 172,165,867 M1L probably benign Het
Ddx31 T A 2: 28,844,982 F52I probably benign Het
Eps15 G A 4: 109,382,866 S852N possibly damaging Het
Fchsd1 A T 18: 37,962,775 L552Q probably damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Frem2 T C 3: 53,655,824 M421V probably benign Het
Gm1110 T G 9: 26,920,747 H36P probably benign Het
Gm11639 A T 11: 104,785,008 Y1542F probably benign Het
Hadha C T 5: 30,120,044 probably null Het
Hspa4 C T 11: 53,262,939 E702K probably benign Het
Intu C A 3: 40,675,326 T362K probably damaging Het
Jaml C T 9: 45,097,919 T248I probably damaging Het
Kcnj1 A T 9: 32,396,867 S176C probably damaging Het
Kcnj9 A G 1: 172,326,137 L140P probably damaging Het
Kif7 T C 7: 79,702,143 K957R probably damaging Het
Klc4 T A 17: 46,636,679 I366F probably damaging Het
Lamb2 A G 9: 108,488,199 probably null Het
Madd T C 2: 91,178,104 D151G probably benign Het
Man2a1 C A 17: 64,710,826 A689E probably damaging Het
Mapk8ip1 C A 2: 92,389,244 G81C probably damaging Het
Msmp T C 4: 43,583,909 Y48C probably damaging Het
Muc6 T C 7: 141,648,821 N567S probably damaging Het
Nrap C T 19: 56,379,875 A192T possibly damaging Het
Nrap A G 19: 56,354,221 Y748H probably damaging Het
Olfr1138 G C 2: 87,737,896 Q143E possibly damaging Het
Olfr1370 T A 13: 21,072,690 T204S possibly damaging Het
Olfr1384 T A 11: 49,514,165 F176I possibly damaging Het
Pcdhb8 T G 18: 37,357,169 D633E possibly damaging Het
Pcdhb9 G A 18: 37,403,154 V734M probably damaging Het
Plscr1 T C 9: 92,259,321 Y21H unknown Het
Ptprz1 T C 6: 23,051,990 Y1424H probably damaging Het
Sec31a T A 5: 100,386,184 Q118L probably benign Het
Selenop A G 15: 3,274,734 S21G probably damaging Het
Shank1 G A 7: 44,352,253 S1132N unknown Het
Slf1 A G 13: 77,084,383 L534P probably damaging Het
Sparcl1 T A 5: 104,085,147 H596L probably damaging Het
Spocd1 C T 4: 129,957,108 probably null Het
Tbc1d24 A T 17: 24,185,993 I59N probably damaging Het
Tctex1d1 A G 4: 102,988,667 N32S probably benign Het
Tjp3 G A 10: 81,277,276 T580I probably benign Het
Tmem154 C T 3: 84,684,296 T51M possibly damaging Het
Tmem8b G A 4: 43,690,246 V894I probably benign Het
Trbv20 A T 6: 41,188,906 L88F possibly damaging Het
Tssk2 A C 16: 17,898,948 I72L possibly damaging Het
Tub T A 7: 109,027,058 I267N probably damaging Het
Vmn2r104 A T 17: 20,041,567 F434I possibly damaging Het
Vmn2r42 T C 7: 8,192,734 N471S probably damaging Het
Vmn2r94 C G 17: 18,258,123 G121R probably damaging Het
Wdr72 T C 9: 74,148,223 S245P probably damaging Het
Zbtb42 A G 12: 112,679,535 Y48C probably damaging Het
Zdbf2 T C 1: 63,304,433 V657A possibly damaging Het
Zfp768 A T 7: 127,344,091 C288* probably null Het
Zfp988 T A 4: 147,332,013 C301* probably null Het
Other mutations in Ptk2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01346:Ptk2b APN 14 66177118 missense possibly damaging 0.54
IGL01940:Ptk2b APN 14 66158613 missense probably benign 0.00
IGL02121:Ptk2b APN 14 66213482 missense probably benign 0.12
IGL02505:Ptk2b APN 14 66154243 missense probably damaging 1.00
IGL03036:Ptk2b APN 14 66173895 splice site probably benign
IGL03343:Ptk2b APN 14 66169421 missense probably benign 0.10
FR4548:Ptk2b UTSW 14 66173849 missense possibly damaging 0.95
FR4737:Ptk2b UTSW 14 66173849 missense possibly damaging 0.95
R0217:Ptk2b UTSW 14 66156381 missense probably damaging 1.00
R0478:Ptk2b UTSW 14 66213372 missense probably damaging 1.00
R0556:Ptk2b UTSW 14 66172144 missense probably damaging 1.00
R0631:Ptk2b UTSW 14 66177751 missense probably damaging 0.96
R0946:Ptk2b UTSW 14 66158598 missense probably benign 0.02
R1502:Ptk2b UTSW 14 66163080 missense possibly damaging 0.95
R1583:Ptk2b UTSW 14 66163114 missense possibly damaging 0.75
R1876:Ptk2b UTSW 14 66158392 missense probably benign 0.01
R1905:Ptk2b UTSW 14 66158670 missense probably damaging 1.00
R1942:Ptk2b UTSW 14 66169381 missense probably damaging 1.00
R2048:Ptk2b UTSW 14 66172505 missense probably benign 0.28
R2377:Ptk2b UTSW 14 66172548 missense possibly damaging 0.56
R3021:Ptk2b UTSW 14 66178183 splice site probably null
R3793:Ptk2b UTSW 14 66170251 missense probably damaging 1.00
R3836:Ptk2b UTSW 14 66156342 missense probably damaging 1.00
R3911:Ptk2b UTSW 14 66157068 missense possibly damaging 0.83
R4654:Ptk2b UTSW 14 66163047 missense possibly damaging 0.86
R4690:Ptk2b UTSW 14 66173300 splice site probably null
R4691:Ptk2b UTSW 14 66157069 missense probably benign 0.16
R4692:Ptk2b UTSW 14 66157069 missense probably benign 0.16
R4693:Ptk2b UTSW 14 66157069 missense probably benign 0.16
R4847:Ptk2b UTSW 14 66173882 missense probably damaging 1.00
R5176:Ptk2b UTSW 14 66156415 missense probably damaging 1.00
R5297:Ptk2b UTSW 14 66172517 missense probably benign 0.04
R5603:Ptk2b UTSW 14 66172065 nonsense probably null
R5935:Ptk2b UTSW 14 66173879 missense probably damaging 1.00
R6313:Ptk2b UTSW 14 66178831 missense probably damaging 1.00
R6476:Ptk2b UTSW 14 66187474 missense possibly damaging 0.81
R6858:Ptk2b UTSW 14 66213398 missense probably damaging 1.00
R7235:Ptk2b UTSW 14 66157087 nonsense probably null
R7511:Ptk2b UTSW 14 66154244 missense possibly damaging 0.81
R7558:Ptk2b UTSW 14 66154179 missense possibly damaging 0.83
R7838:Ptk2b UTSW 14 66158401 missense probably benign
X0054:Ptk2b UTSW 14 66213328 missense probably benign 0.15
Y5405:Ptk2b UTSW 14 66154094 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGCTGATATGTTTGCAAAGG -3'
(R):5'- GCCACAGTAGAGCAAGTCTG -3'

Sequencing Primer
(F):5'- CTGATATGTTTGCAAAGGGAAGAG -3'
(R):5'- AAGTCTGCACCCCCATGG -3'
Posted On2018-02-28