Incidental Mutation 'R6245:Vmn2r104'
ID 505556
Institutional Source Beutler Lab
Gene Symbol Vmn2r104
Ensembl Gene ENSMUSG00000090315
Gene Name vomeronasal 2, receptor 104
Synonyms V2r7
MMRRC Submission 044403-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.108) question?
Stock # R6245 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 20249687-20268467 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 20261829 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 434 (F434I)
Ref Sequence ENSEMBL: ENSMUSP00000129895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168050]
AlphaFold E9Q2J5
Predicted Effect possibly damaging
Transcript: ENSMUST00000168050
AA Change: F434I

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000129895
Gene: ENSMUSG00000090315
AA Change: F434I

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 85 457 4e-38 PFAM
Pfam:NCD3G 512 565 2.1e-20 PFAM
Pfam:7tm_3 598 833 1.7e-52 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A G 11: 110,026,249 (GRCm39) I937T probably damaging Het
Adgrl3 T A 5: 81,836,403 (GRCm39) N720K probably benign Het
Akr1c21 T G 13: 4,625,231 (GRCm39) V54G possibly damaging Het
Alpi G T 1: 87,028,556 (GRCm39) D111E probably damaging Het
Armc3 C T 2: 19,253,516 (GRCm39) T219M probably damaging Het
Bms1 T A 6: 118,373,797 (GRCm39) E780V probably damaging Het
Ccdc159 T C 9: 21,846,864 (GRCm39) S244P probably damaging Het
Cdon T C 9: 35,388,235 (GRCm39) W737R probably damaging Het
Chdh T A 14: 29,757,262 (GRCm39) V395D probably damaging Het
Col22a1 C A 15: 71,845,665 (GRCm39) D366Y probably damaging Het
Cplane1 T C 15: 8,207,902 (GRCm39) Y218H probably benign Het
Crnkl1 T A 2: 145,770,051 (GRCm39) N264I probably benign Het
Ctnnd2 T C 15: 30,905,894 (GRCm39) L847P probably damaging Het
Cyp4a31 A C 4: 115,428,545 (GRCm39) T382P possibly damaging Het
Dcaf8 A T 1: 171,993,434 (GRCm39) M1L probably benign Het
Ddx31 T A 2: 28,734,994 (GRCm39) F52I probably benign Het
Dynlt5 A G 4: 102,845,864 (GRCm39) N32S probably benign Het
Efcab3 A T 11: 104,675,834 (GRCm39) Y1542F probably benign Het
Eps15 G A 4: 109,240,063 (GRCm39) S852N possibly damaging Het
Fchsd1 A T 18: 38,095,828 (GRCm39) L552Q probably damaging Het
Fetub C T 16: 22,751,081 (GRCm39) R143C probably damaging Het
Frem2 T C 3: 53,563,245 (GRCm39) M421V probably benign Het
Gm1110 T G 9: 26,832,043 (GRCm39) H36P probably benign Het
Hadha C T 5: 30,325,042 (GRCm39) probably null Het
Hspa4 C T 11: 53,153,766 (GRCm39) E702K probably benign Het
Intu C A 3: 40,629,756 (GRCm39) T362K probably damaging Het
Jaml C T 9: 45,009,217 (GRCm39) T248I probably damaging Het
Kcnj1 A T 9: 32,308,163 (GRCm39) S176C probably damaging Het
Kcnj9 A G 1: 172,153,704 (GRCm39) L140P probably damaging Het
Kif7 T C 7: 79,351,891 (GRCm39) K957R probably damaging Het
Klc4 T A 17: 46,947,605 (GRCm39) I366F probably damaging Het
Lamb2 A G 9: 108,365,398 (GRCm39) probably null Het
Madd T C 2: 91,008,449 (GRCm39) D151G probably benign Het
Man2a1 C A 17: 65,017,821 (GRCm39) A689E probably damaging Het
Mapk8ip1 C A 2: 92,219,589 (GRCm39) G81C probably damaging Het
Msmp T C 4: 43,583,909 (GRCm39) Y48C probably damaging Het
Muc6 T C 7: 141,235,086 (GRCm39) N567S probably damaging Het
Nrap A G 19: 56,342,653 (GRCm39) Y748H probably damaging Het
Nrap C T 19: 56,368,307 (GRCm39) A192T possibly damaging Het
Or2p2 T A 13: 21,256,860 (GRCm39) T204S possibly damaging Het
Or2y14 T A 11: 49,404,992 (GRCm39) F176I possibly damaging Het
Or5w15 G C 2: 87,568,240 (GRCm39) Q143E possibly damaging Het
Pcdhb8 T G 18: 37,490,222 (GRCm39) D633E possibly damaging Het
Pcdhb9 G A 18: 37,536,207 (GRCm39) V734M probably damaging Het
Plscr1 T C 9: 92,141,374 (GRCm39) Y21H unknown Het
Ptk2b G T 14: 66,400,515 (GRCm39) P767T probably damaging Het
Ptprz1 T C 6: 23,051,989 (GRCm39) Y1424H probably damaging Het
Sec31a T A 5: 100,534,043 (GRCm39) Q118L probably benign Het
Selenop A G 15: 3,304,216 (GRCm39) S21G probably damaging Het
Shank1 G A 7: 44,001,677 (GRCm39) S1132N unknown Het
Slf1 A G 13: 77,232,502 (GRCm39) L534P probably damaging Het
Sparcl1 T A 5: 104,233,013 (GRCm39) H596L probably damaging Het
Spocd1 C T 4: 129,850,901 (GRCm39) probably null Het
Tbc1d24 A T 17: 24,404,967 (GRCm39) I59N probably damaging Het
Tjp3 G A 10: 81,113,110 (GRCm39) T580I probably benign Het
Tmem154 C T 3: 84,591,603 (GRCm39) T51M possibly damaging Het
Tmem8b G A 4: 43,690,246 (GRCm39) V894I probably benign Het
Trbv20 A T 6: 41,165,840 (GRCm39) L88F possibly damaging Het
Tssk2 A C 16: 17,716,812 (GRCm39) I72L possibly damaging Het
Tub T A 7: 108,626,265 (GRCm39) I267N probably damaging Het
Vmn2r42 T C 7: 8,195,733 (GRCm39) N471S probably damaging Het
Vmn2r94 C G 17: 18,478,385 (GRCm39) G121R probably damaging Het
Wdr72 T C 9: 74,055,505 (GRCm39) S245P probably damaging Het
Zbtb42 A G 12: 112,645,969 (GRCm39) Y48C probably damaging Het
Zdbf2 T C 1: 63,343,592 (GRCm39) V657A possibly damaging Het
Zfp768 A T 7: 126,943,263 (GRCm39) C288* probably null Het
Zfp988 T A 4: 147,416,470 (GRCm39) C301* probably null Het
Other mutations in Vmn2r104
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Vmn2r104 APN 17 20,258,501 (GRCm39) missense probably damaging 0.98
IGL01098:Vmn2r104 APN 17 20,268,358 (GRCm39) missense probably benign 0.27
IGL01333:Vmn2r104 APN 17 20,263,055 (GRCm39) missense probably benign 0.17
IGL01527:Vmn2r104 APN 17 20,263,158 (GRCm39) missense possibly damaging 0.82
IGL01773:Vmn2r104 APN 17 20,260,930 (GRCm39) missense probably benign 0.10
IGL01939:Vmn2r104 APN 17 20,250,187 (GRCm39) missense probably damaging 0.99
IGL02121:Vmn2r104 APN 17 20,262,056 (GRCm39) nonsense probably null
IGL02305:Vmn2r104 APN 17 20,263,118 (GRCm39) missense probably benign 0.09
IGL02374:Vmn2r104 APN 17 20,263,048 (GRCm39) missense probably benign 0.34
IGL03260:Vmn2r104 APN 17 20,263,083 (GRCm39) missense probably benign 0.05
IGL03366:Vmn2r104 APN 17 20,249,866 (GRCm39) missense probably damaging 1.00
R0091:Vmn2r104 UTSW 17 20,262,075 (GRCm39) missense possibly damaging 0.79
R0125:Vmn2r104 UTSW 17 20,250,069 (GRCm39) missense probably damaging 0.98
R0257:Vmn2r104 UTSW 17 20,249,889 (GRCm39) missense probably damaging 1.00
R0381:Vmn2r104 UTSW 17 20,268,264 (GRCm39) nonsense probably null
R0709:Vmn2r104 UTSW 17 20,263,166 (GRCm39) missense probably damaging 1.00
R0786:Vmn2r104 UTSW 17 20,262,987 (GRCm39) missense probably benign
R1575:Vmn2r104 UTSW 17 20,262,477 (GRCm39) missense probably damaging 1.00
R1827:Vmn2r104 UTSW 17 20,262,497 (GRCm39) missense probably damaging 0.97
R1932:Vmn2r104 UTSW 17 20,261,031 (GRCm39) missense probably damaging 1.00
R1956:Vmn2r104 UTSW 17 20,262,313 (GRCm39) missense probably damaging 0.98
R2203:Vmn2r104 UTSW 17 20,250,083 (GRCm39) missense probably benign 0.05
R2205:Vmn2r104 UTSW 17 20,250,083 (GRCm39) missense probably benign 0.05
R2859:Vmn2r104 UTSW 17 20,268,455 (GRCm39) missense possibly damaging 0.82
R3701:Vmn2r104 UTSW 17 20,249,818 (GRCm39) missense probably damaging 1.00
R3834:Vmn2r104 UTSW 17 20,250,183 (GRCm39) missense probably benign 0.02
R4151:Vmn2r104 UTSW 17 20,250,147 (GRCm39) missense probably damaging 1.00
R4470:Vmn2r104 UTSW 17 20,262,503 (GRCm39) missense probably damaging 1.00
R4625:Vmn2r104 UTSW 17 20,268,443 (GRCm39) missense probably benign 0.00
R4754:Vmn2r104 UTSW 17 20,261,030 (GRCm39) nonsense probably null
R4911:Vmn2r104 UTSW 17 20,250,288 (GRCm39) missense probably benign 0.00
R5270:Vmn2r104 UTSW 17 20,258,528 (GRCm39) missense probably damaging 1.00
R5279:Vmn2r104 UTSW 17 20,262,146 (GRCm39) missense probably benign 0.07
R5311:Vmn2r104 UTSW 17 20,250,163 (GRCm39) missense probably damaging 1.00
R5370:Vmn2r104 UTSW 17 20,250,450 (GRCm39) missense probably damaging 0.97
R5461:Vmn2r104 UTSW 17 20,250,343 (GRCm39) missense probably damaging 1.00
R5683:Vmn2r104 UTSW 17 20,260,981 (GRCm39) nonsense probably null
R5795:Vmn2r104 UTSW 17 20,250,544 (GRCm39) missense possibly damaging 0.89
R5795:Vmn2r104 UTSW 17 20,250,372 (GRCm39) missense probably benign 0.02
R5970:Vmn2r104 UTSW 17 20,249,733 (GRCm39) missense probably benign 0.01
R5983:Vmn2r104 UTSW 17 20,261,970 (GRCm39) missense probably damaging 1.00
R5992:Vmn2r104 UTSW 17 20,249,747 (GRCm39) missense probably damaging 1.00
R6066:Vmn2r104 UTSW 17 20,258,573 (GRCm39) missense possibly damaging 0.69
R6156:Vmn2r104 UTSW 17 20,261,909 (GRCm39) missense probably damaging 1.00
R6182:Vmn2r104 UTSW 17 20,250,507 (GRCm39) missense probably benign 0.16
R6333:Vmn2r104 UTSW 17 20,249,848 (GRCm39) missense probably benign 0.30
R6573:Vmn2r104 UTSW 17 20,262,487 (GRCm39) missense probably damaging 1.00
R7101:Vmn2r104 UTSW 17 20,250,358 (GRCm39) missense possibly damaging 0.65
R7123:Vmn2r104 UTSW 17 20,261,088 (GRCm39) missense probably benign 0.12
R7485:Vmn2r104 UTSW 17 20,249,737 (GRCm39) missense probably benign 0.01
R7514:Vmn2r104 UTSW 17 20,249,791 (GRCm39) missense probably damaging 1.00
R7634:Vmn2r104 UTSW 17 20,261,971 (GRCm39) missense possibly damaging 0.48
R7958:Vmn2r104 UTSW 17 20,262,988 (GRCm39) missense probably benign
R8031:Vmn2r104 UTSW 17 20,263,048 (GRCm39) missense probably benign 0.34
R8094:Vmn2r104 UTSW 17 20,250,483 (GRCm39) missense possibly damaging 0.77
R8191:Vmn2r104 UTSW 17 20,250,465 (GRCm39) missense possibly damaging 0.89
R8308:Vmn2r104 UTSW 17 20,261,040 (GRCm39) missense possibly damaging 0.55
R8691:Vmn2r104 UTSW 17 20,262,110 (GRCm39) missense probably damaging 0.98
R8795:Vmn2r104 UTSW 17 20,262,988 (GRCm39) missense probably benign
R8900:Vmn2r104 UTSW 17 20,261,924 (GRCm39) missense probably damaging 0.99
R8913:Vmn2r104 UTSW 17 20,249,968 (GRCm39) missense probably damaging 1.00
R9180:Vmn2r104 UTSW 17 20,263,087 (GRCm39) missense probably benign 0.00
R9199:Vmn2r104 UTSW 17 20,262,097 (GRCm39) missense probably damaging 0.99
R9282:Vmn2r104 UTSW 17 20,261,098 (GRCm39) missense probably damaging 1.00
R9303:Vmn2r104 UTSW 17 20,268,439 (GRCm39) missense possibly damaging 0.90
R9305:Vmn2r104 UTSW 17 20,268,439 (GRCm39) missense possibly damaging 0.90
R9322:Vmn2r104 UTSW 17 20,263,087 (GRCm39) missense probably benign 0.00
R9325:Vmn2r104 UTSW 17 20,268,433 (GRCm39) missense possibly damaging 0.95
R9414:Vmn2r104 UTSW 17 20,250,250 (GRCm39) missense probably damaging 0.99
R9785:Vmn2r104 UTSW 17 20,268,409 (GRCm39) missense probably benign
RF007:Vmn2r104 UTSW 17 20,268,302 (GRCm39) missense probably benign 0.36
Z1177:Vmn2r104 UTSW 17 20,250,051 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGTACCTCACAACATCATACACTTG -3'
(R):5'- CATGTTAGACTCATTCCATGGAAG -3'

Sequencing Primer
(F):5'- TGTGGACAAGACAAACTGA -3'
(R):5'- CCATGGAAGTTTCATTTTTAGACAC -3'
Posted On 2018-02-28