Incidental Mutation 'R6245:Man2a1'
ID505559
Institutional Source Beutler Lab
Gene Symbol Man2a1
Ensembl Gene ENSMUSG00000024085
Gene Namemannosidase 2, alpha 1
SynonymsMana2, Map-2, Mana-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.881) question?
Stock #R6245 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location64600736-64755110 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 64710826 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 689 (A689E)
Ref Sequence ENSEMBL: ENSMUSP00000083928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086723] [ENSMUST00000169668]
Predicted Effect probably damaging
Transcript: ENSMUST00000086723
AA Change: A689E

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000083928
Gene: ENSMUSG00000024085
AA Change: A689E

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
coiled coil region 45 74 N/A INTRINSIC
Pfam:Glyco_hydro_38 166 496 2.3e-111 PFAM
Alpha-mann_mid 501 587 5.39e-34 SMART
Pfam:Glyco_hydro_38C 648 1144 1.5e-98 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169239
Predicted Effect probably benign
Transcript: ENSMUST00000169668
SMART Domains Protein: ENSMUSP00000130529
Gene: ENSMUSG00000024085

DomainStartEndE-ValueType
Pfam:Glyco_hydro_38C 1 268 1.6e-50 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosyl hydrolase that localizes to the Golgi and catalyzes the final hydrolytic step in the asparagine-linked oligosaccharide (N-glycan) maturation pathway. Mutations in the mouse homolog of this gene have been shown to cause a systemic autoimmune disease similar to human systemic lupus erythematosus. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygous mutation of this gene results in premature death, dyserythropoiesis, systemic autoimmune disease, including an increase in serum immunoglobulins, glomerulonephritis, and hematuria, [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,178,418 Y218H probably benign Het
Abca9 A G 11: 110,135,423 I937T probably damaging Het
Adgrl3 T A 5: 81,688,556 N720K probably benign Het
Akr1c21 T G 13: 4,575,232 V54G possibly damaging Het
Alpi G T 1: 87,100,834 D111E probably damaging Het
Armc3 C T 2: 19,248,705 T219M probably damaging Het
Bms1 T A 6: 118,396,836 E780V probably damaging Het
Ccdc159 T C 9: 21,935,568 S244P probably damaging Het
Cdon T C 9: 35,476,939 W737R probably damaging Het
Chdh T A 14: 30,035,305 V395D probably damaging Het
Col22a1 C A 15: 71,973,816 D366Y probably damaging Het
Crnkl1 T A 2: 145,928,131 N264I probably benign Het
Ctnnd2 T C 15: 30,905,748 L847P probably damaging Het
Cyp4a31 A C 4: 115,571,348 T382P possibly damaging Het
Dcaf8 A T 1: 172,165,867 M1L probably benign Het
Ddx31 T A 2: 28,844,982 F52I probably benign Het
Eps15 G A 4: 109,382,866 S852N possibly damaging Het
Fchsd1 A T 18: 37,962,775 L552Q probably damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Frem2 T C 3: 53,655,824 M421V probably benign Het
Gm1110 T G 9: 26,920,747 H36P probably benign Het
Gm11639 A T 11: 104,785,008 Y1542F probably benign Het
Hadha C T 5: 30,120,044 probably null Het
Hspa4 C T 11: 53,262,939 E702K probably benign Het
Intu C A 3: 40,675,326 T362K probably damaging Het
Jaml C T 9: 45,097,919 T248I probably damaging Het
Kcnj1 A T 9: 32,396,867 S176C probably damaging Het
Kcnj9 A G 1: 172,326,137 L140P probably damaging Het
Kif7 T C 7: 79,702,143 K957R probably damaging Het
Klc4 T A 17: 46,636,679 I366F probably damaging Het
Lamb2 A G 9: 108,488,199 probably null Het
Madd T C 2: 91,178,104 D151G probably benign Het
Mapk8ip1 C A 2: 92,389,244 G81C probably damaging Het
Msmp T C 4: 43,583,909 Y48C probably damaging Het
Muc6 T C 7: 141,648,821 N567S probably damaging Het
Nrap A G 19: 56,354,221 Y748H probably damaging Het
Nrap C T 19: 56,379,875 A192T possibly damaging Het
Olfr1138 G C 2: 87,737,896 Q143E possibly damaging Het
Olfr1370 T A 13: 21,072,690 T204S possibly damaging Het
Olfr1384 T A 11: 49,514,165 F176I possibly damaging Het
Pcdhb8 T G 18: 37,357,169 D633E possibly damaging Het
Pcdhb9 G A 18: 37,403,154 V734M probably damaging Het
Plscr1 T C 9: 92,259,321 Y21H unknown Het
Ptk2b G T 14: 66,163,066 P767T probably damaging Het
Ptprz1 T C 6: 23,051,990 Y1424H probably damaging Het
Sec31a T A 5: 100,386,184 Q118L probably benign Het
Selenop A G 15: 3,274,734 S21G probably damaging Het
Shank1 G A 7: 44,352,253 S1132N unknown Het
Slf1 A G 13: 77,084,383 L534P probably damaging Het
Sparcl1 T A 5: 104,085,147 H596L probably damaging Het
Spocd1 C T 4: 129,957,108 probably null Het
Tbc1d24 A T 17: 24,185,993 I59N probably damaging Het
Tctex1d1 A G 4: 102,988,667 N32S probably benign Het
Tjp3 G A 10: 81,277,276 T580I probably benign Het
Tmem154 C T 3: 84,684,296 T51M possibly damaging Het
Tmem8b G A 4: 43,690,246 V894I probably benign Het
Trbv20 A T 6: 41,188,906 L88F possibly damaging Het
Tssk2 A C 16: 17,898,948 I72L possibly damaging Het
Tub T A 7: 109,027,058 I267N probably damaging Het
Vmn2r104 A T 17: 20,041,567 F434I possibly damaging Het
Vmn2r42 T C 7: 8,192,734 N471S probably damaging Het
Vmn2r94 C G 17: 18,258,123 G121R probably damaging Het
Wdr72 T C 9: 74,148,223 S245P probably damaging Het
Zbtb42 A G 12: 112,679,535 Y48C probably damaging Het
Zdbf2 T C 1: 63,304,433 V657A possibly damaging Het
Zfp768 A T 7: 127,344,091 C288* probably null Het
Zfp988 T A 4: 147,332,013 C301* probably null Het
Other mutations in Man2a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01390:Man2a1 APN 17 64710705 missense probably benign 0.00
IGL01823:Man2a1 APN 17 64666824 missense probably damaging 0.99
IGL02012:Man2a1 APN 17 64666899 missense probably damaging 0.98
IGL02589:Man2a1 APN 17 64679778 missense probably benign 0.01
IGL03248:Man2a1 APN 17 64713611 missense probably damaging 1.00
R0070:Man2a1 UTSW 17 64659079 splice site probably null
R0092:Man2a1 UTSW 17 64659084 splice site probably benign
R1347:Man2a1 UTSW 17 64712450 missense probably damaging 0.98
R1347:Man2a1 UTSW 17 64712450 missense probably damaging 0.98
R1376:Man2a1 UTSW 17 64672043 missense possibly damaging 0.50
R1376:Man2a1 UTSW 17 64672043 missense possibly damaging 0.50
R1599:Man2a1 UTSW 17 64679831 missense possibly damaging 0.80
R1799:Man2a1 UTSW 17 64669497 missense probably damaging 1.00
R1799:Man2a1 UTSW 17 64752457 missense probably benign 0.12
R1822:Man2a1 UTSW 17 64740842 missense probably damaging 1.00
R1958:Man2a1 UTSW 17 64750835 missense probably benign 0.00
R2852:Man2a1 UTSW 17 64713601 missense probably benign 0.00
R4324:Man2a1 UTSW 17 64666793 missense probably benign 0.00
R4582:Man2a1 UTSW 17 64752499 missense probably benign 0.00
R4610:Man2a1 UTSW 17 64712459 missense probably benign
R4803:Man2a1 UTSW 17 64659009 missense probably damaging 1.00
R5072:Man2a1 UTSW 17 64659079 splice site probably null
R5109:Man2a1 UTSW 17 64752448 missense probably benign 0.31
R5223:Man2a1 UTSW 17 64712271 missense probably benign 0.17
R5229:Man2a1 UTSW 17 64710734 missense probably benign 0.00
R5238:Man2a1 UTSW 17 64636507 missense probably damaging 1.00
R5273:Man2a1 UTSW 17 64733785 missense probably damaging 1.00
R5289:Man2a1 UTSW 17 64651227 missense probably damaging 0.99
R5352:Man2a1 UTSW 17 64731246 missense probably damaging 1.00
R5428:Man2a1 UTSW 17 64712300 missense probably benign 0.00
R5898:Man2a1 UTSW 17 64625380 missense probably benign 0.01
R5942:Man2a1 UTSW 17 64625380 missense probably benign 0.01
R5943:Man2a1 UTSW 17 64625380 missense probably benign 0.01
R5963:Man2a1 UTSW 17 64675122 missense probably benign
R5969:Man2a1 UTSW 17 64625380 missense probably benign 0.01
R5970:Man2a1 UTSW 17 64625380 missense probably benign 0.01
R6164:Man2a1 UTSW 17 64733724 missense possibly damaging 0.87
R6207:Man2a1 UTSW 17 64713605 missense probably benign 0.02
R6724:Man2a1 UTSW 17 64731269 missense possibly damaging 0.91
R6759:Man2a1 UTSW 17 64625388 missense probably benign 0.00
R6778:Man2a1 UTSW 17 64714635 missense possibly damaging 0.69
R7250:Man2a1 UTSW 17 64636588 missense probably benign 0.00
R7354:Man2a1 UTSW 17 64752544 missense probably damaging 1.00
R7833:Man2a1 UTSW 17 64666751 missense probably damaging 0.99
R7991:Man2a1 UTSW 17 64601776 missense probably benign 0.28
RF007:Man2a1 UTSW 17 64712253 missense probably damaging 0.98
Z1177:Man2a1 UTSW 17 64659020 missense probably damaging 1.00
Z1177:Man2a1 UTSW 17 64735054 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTGGAAACTGAAGCCTTAGG -3'
(R):5'- AGCCACCCAGTTACATCCTCTG -3'

Sequencing Primer
(F):5'- ACTGAAGCCTTAGGAAGTGTC -3'
(R):5'- GGTATTAGACTTCACTCCCGTG -3'
Posted On2018-02-28