Incidental Mutation 'R6245:Pcdhb8'
ID505560
Institutional Source Beutler Lab
Gene Symbol Pcdhb8
Ensembl Gene ENSMUSG00000045876
Gene Nameprotocadherin beta 8
SynonymsPcdhb5C, PcdhbH
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R6245 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location37355121-37358604 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 37357169 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 633 (D633E)
Ref Sequence ENSEMBL: ENSMUSP00000054371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051163] [ENSMUST00000115661] [ENSMUST00000192867] [ENSMUST00000194544]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051163
AA Change: D633E

PolyPhen 2 Score 0.803 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000054371
Gene: ENSMUSG00000045876
AA Change: D633E

DomainStartEndE-ValueType
Pfam:Cadherin_2 30 112 6.6e-33 PFAM
CA 155 240 7.79e-22 SMART
CA 264 344 3.02e-28 SMART
CA 367 448 1.14e-23 SMART
CA 472 558 9.51e-26 SMART
CA 588 669 5.65e-10 SMART
Pfam:Cadherin_C_2 685 768 1.1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192867
SMART Domains Protein: ENSMUSP00000141814
Gene: ENSMUSG00000045876

DomainStartEndE-ValueType
CA 26 104 7e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,178,418 Y218H probably benign Het
Abca9 A G 11: 110,135,423 I937T probably damaging Het
Adgrl3 T A 5: 81,688,556 N720K probably benign Het
Akr1c21 T G 13: 4,575,232 V54G possibly damaging Het
Alpi G T 1: 87,100,834 D111E probably damaging Het
Armc3 C T 2: 19,248,705 T219M probably damaging Het
Bms1 T A 6: 118,396,836 E780V probably damaging Het
Ccdc159 T C 9: 21,935,568 S244P probably damaging Het
Cdon T C 9: 35,476,939 W737R probably damaging Het
Chdh T A 14: 30,035,305 V395D probably damaging Het
Col22a1 C A 15: 71,973,816 D366Y probably damaging Het
Crnkl1 T A 2: 145,928,131 N264I probably benign Het
Ctnnd2 T C 15: 30,905,748 L847P probably damaging Het
Cyp4a31 A C 4: 115,571,348 T382P possibly damaging Het
Dcaf8 A T 1: 172,165,867 M1L probably benign Het
Ddx31 T A 2: 28,844,982 F52I probably benign Het
Eps15 G A 4: 109,382,866 S852N possibly damaging Het
Fchsd1 A T 18: 37,962,775 L552Q probably damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Frem2 T C 3: 53,655,824 M421V probably benign Het
Gm1110 T G 9: 26,920,747 H36P probably benign Het
Gm11639 A T 11: 104,785,008 Y1542F probably benign Het
Hadha C T 5: 30,120,044 probably null Het
Hspa4 C T 11: 53,262,939 E702K probably benign Het
Intu C A 3: 40,675,326 T362K probably damaging Het
Jaml C T 9: 45,097,919 T248I probably damaging Het
Kcnj1 A T 9: 32,396,867 S176C probably damaging Het
Kcnj9 A G 1: 172,326,137 L140P probably damaging Het
Kif7 T C 7: 79,702,143 K957R probably damaging Het
Klc4 T A 17: 46,636,679 I366F probably damaging Het
Lamb2 A G 9: 108,488,199 probably null Het
Madd T C 2: 91,178,104 D151G probably benign Het
Man2a1 C A 17: 64,710,826 A689E probably damaging Het
Mapk8ip1 C A 2: 92,389,244 G81C probably damaging Het
Msmp T C 4: 43,583,909 Y48C probably damaging Het
Muc6 T C 7: 141,648,821 N567S probably damaging Het
Nrap A G 19: 56,354,221 Y748H probably damaging Het
Nrap C T 19: 56,379,875 A192T possibly damaging Het
Olfr1138 G C 2: 87,737,896 Q143E possibly damaging Het
Olfr1370 T A 13: 21,072,690 T204S possibly damaging Het
Olfr1384 T A 11: 49,514,165 F176I possibly damaging Het
Pcdhb9 G A 18: 37,403,154 V734M probably damaging Het
Plscr1 T C 9: 92,259,321 Y21H unknown Het
Ptk2b G T 14: 66,163,066 P767T probably damaging Het
Ptprz1 T C 6: 23,051,990 Y1424H probably damaging Het
Sec31a T A 5: 100,386,184 Q118L probably benign Het
Selenop A G 15: 3,274,734 S21G probably damaging Het
Shank1 G A 7: 44,352,253 S1132N unknown Het
Slf1 A G 13: 77,084,383 L534P probably damaging Het
Sparcl1 T A 5: 104,085,147 H596L probably damaging Het
Spocd1 C T 4: 129,957,108 probably null Het
Tbc1d24 A T 17: 24,185,993 I59N probably damaging Het
Tctex1d1 A G 4: 102,988,667 N32S probably benign Het
Tjp3 G A 10: 81,277,276 T580I probably benign Het
Tmem154 C T 3: 84,684,296 T51M possibly damaging Het
Tmem8b G A 4: 43,690,246 V894I probably benign Het
Trbv20 A T 6: 41,188,906 L88F possibly damaging Het
Tssk2 A C 16: 17,898,948 I72L possibly damaging Het
Tub T A 7: 109,027,058 I267N probably damaging Het
Vmn2r104 A T 17: 20,041,567 F434I possibly damaging Het
Vmn2r42 T C 7: 8,192,734 N471S probably damaging Het
Vmn2r94 C G 17: 18,258,123 G121R probably damaging Het
Wdr72 T C 9: 74,148,223 S245P probably damaging Het
Zbtb42 A G 12: 112,679,535 Y48C probably damaging Het
Zdbf2 T C 1: 63,304,433 V657A possibly damaging Het
Zfp768 A T 7: 127,344,091 C288* probably null Het
Zfp988 T A 4: 147,332,013 C301* probably null Het
Other mutations in Pcdhb8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Pcdhb8 APN 18 37355473 missense probably benign 0.00
IGL00574:Pcdhb8 APN 18 37356370 missense probably damaging 1.00
IGL00960:Pcdhb8 APN 18 37355973 missense probably benign 0.28
IGL01103:Pcdhb8 APN 18 37357200 missense probably damaging 1.00
IGL01330:Pcdhb8 APN 18 37357578 missense probably benign 0.12
IGL01413:Pcdhb8 APN 18 37355976 missense probably damaging 1.00
IGL01418:Pcdhb8 APN 18 37355976 missense probably damaging 1.00
IGL01608:Pcdhb8 APN 18 37356925 missense probably damaging 1.00
IGL02212:Pcdhb8 APN 18 37356412 missense possibly damaging 0.95
IGL02582:Pcdhb8 APN 18 37355374 missense possibly damaging 0.79
IGL02607:Pcdhb8 APN 18 37357581 missense probably benign 0.00
IGL02882:Pcdhb8 APN 18 37356223 missense possibly damaging 0.95
IGL03005:Pcdhb8 APN 18 37357534 missense probably damaging 1.00
IGL03108:Pcdhb8 APN 18 37357246 missense probably damaging 1.00
PIT4468001:Pcdhb8 UTSW 18 37356633 missense probably damaging 1.00
R0104:Pcdhb8 UTSW 18 37355665 missense probably benign 0.01
R0490:Pcdhb8 UTSW 18 37356780 missense probably damaging 1.00
R0617:Pcdhb8 UTSW 18 37357047 missense probably benign 0.02
R1168:Pcdhb8 UTSW 18 37356727 missense probably benign
R1189:Pcdhb8 UTSW 18 37356567 nonsense probably null
R1232:Pcdhb8 UTSW 18 37355775 missense probably benign 0.28
R1503:Pcdhb8 UTSW 18 37356519 missense probably damaging 1.00
R1576:Pcdhb8 UTSW 18 37356703 missense probably damaging 1.00
R1731:Pcdhb8 UTSW 18 37355838 missense probably damaging 1.00
R1908:Pcdhb8 UTSW 18 37355962 missense possibly damaging 0.84
R1909:Pcdhb8 UTSW 18 37355962 missense possibly damaging 0.84
R2215:Pcdhb8 UTSW 18 37357074 missense probably damaging 0.98
R3080:Pcdhb8 UTSW 18 37356166 missense probably damaging 1.00
R4394:Pcdhb8 UTSW 18 37356882 missense probably damaging 1.00
R4799:Pcdhb8 UTSW 18 37355653 missense probably damaging 1.00
R4845:Pcdhb8 UTSW 18 37356718 missense probably benign 0.43
R4879:Pcdhb8 UTSW 18 37356166 missense probably damaging 1.00
R4941:Pcdhb8 UTSW 18 37356006 missense probably benign 0.03
R5086:Pcdhb8 UTSW 18 37356106 missense probably damaging 1.00
R5416:Pcdhb8 UTSW 18 37356955 missense probably damaging 1.00
R5774:Pcdhb8 UTSW 18 37356685 missense probably damaging 1.00
R5898:Pcdhb8 UTSW 18 37357484 missense possibly damaging 0.92
R5935:Pcdhb8 UTSW 18 37356190 missense probably damaging 1.00
R6191:Pcdhb8 UTSW 18 37356226 missense probably benign
R6228:Pcdhb8 UTSW 18 37356984 missense probably benign 0.05
R6397:Pcdhb8 UTSW 18 37355463 nonsense probably null
R7469:Pcdhb8 UTSW 18 37355958 missense probably damaging 1.00
R7632:Pcdhb8 UTSW 18 37355595 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAATGACAATGCGCCCTTCG -3'
(R):5'- CCAGATAGAGAGTGAGCATGTC -3'

Sequencing Primer
(F):5'- CACTGCAAAACGCTTCTGC -3'
(R):5'- ATAGAGAGTGAGCATGTCTTCTTCC -3'
Posted On2018-02-28