Incidental Mutation 'R6245:Fchsd1'
ID505562
Institutional Source Beutler Lab
Gene Symbol Fchsd1
Ensembl Gene ENSMUSG00000038524
Gene NameFCH and double SH3 domains 1
SynonymsA030002D08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R6245 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location37957431-37969774 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37962775 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 552 (L552Q)
Ref Sequence ENSEMBL: ENSMUSP00000047878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043437] [ENSMUST00000070709] [ENSMUST00000091932] [ENSMUST00000163128] [ENSMUST00000163131] [ENSMUST00000163591] [ENSMUST00000166148] [ENSMUST00000176902] [ENSMUST00000176104] [ENSMUST00000177058] [ENSMUST00000168056] [ENSMUST00000169498]
Predicted Effect probably damaging
Transcript: ENSMUST00000043437
AA Change: L552Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047878
Gene: ENSMUSG00000038524
AA Change: L552Q

DomainStartEndE-ValueType
Pfam:FCH 21 100 1.6e-19 PFAM
coiled coil region 188 209 N/A INTRINSIC
low complexity region 346 357 N/A INTRINSIC
SH3 469 526 1.34e-8 SMART
SH3 547 606 1.94e-14 SMART
low complexity region 622 634 N/A INTRINSIC
low complexity region 657 686 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000070709
SMART Domains Protein: ENSMUSP00000070280
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
Pfam:RELT 16 64 1.2e-22 PFAM
low complexity region 194 212 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000091932
SMART Domains Protein: ENSMUSP00000089552
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
Pfam:RELT 16 64 8.3e-23 PFAM
low complexity region 194 212 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163128
SMART Domains Protein: ENSMUSP00000127234
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
Pfam:RELT 16 64 5.2e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163131
SMART Domains Protein: ENSMUSP00000133058
Gene: ENSMUSG00000038524

DomainStartEndE-ValueType
Pfam:FCH 12 107 1.6e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163591
SMART Domains Protein: ENSMUSP00000129299
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
low complexity region 103 121 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164499
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165643
Predicted Effect probably benign
Transcript: ENSMUST00000166148
SMART Domains Protein: ENSMUSP00000129825
Gene: ENSMUSG00000038524

DomainStartEndE-ValueType
Pfam:FCH 12 93 1.6e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166531
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166727
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166973
Predicted Effect probably benign
Transcript: ENSMUST00000176902
SMART Domains Protein: ENSMUSP00000135176
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
low complexity region 103 121 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168136
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168816
Predicted Effect probably benign
Transcript: ENSMUST00000176104
SMART Domains Protein: ENSMUSP00000135556
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
Pfam:RELT 16 60 3.3e-22 PFAM
low complexity region 194 212 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177058
SMART Domains Protein: ENSMUSP00000135615
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
Pfam:RELT 16 64 1.2e-22 PFAM
low complexity region 194 212 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168056
SMART Domains Protein: ENSMUSP00000130051
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
Pfam:RELT 16 64 1.9e-23 PFAM
low complexity region 104 116 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169498
SMART Domains Protein: ENSMUSP00000128949
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
low complexity region 103 121 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,178,418 Y218H probably benign Het
Abca9 A G 11: 110,135,423 I937T probably damaging Het
Adgrl3 T A 5: 81,688,556 N720K probably benign Het
Akr1c21 T G 13: 4,575,232 V54G possibly damaging Het
Alpi G T 1: 87,100,834 D111E probably damaging Het
Armc3 C T 2: 19,248,705 T219M probably damaging Het
Bms1 T A 6: 118,396,836 E780V probably damaging Het
Ccdc159 T C 9: 21,935,568 S244P probably damaging Het
Cdon T C 9: 35,476,939 W737R probably damaging Het
Chdh T A 14: 30,035,305 V395D probably damaging Het
Col22a1 C A 15: 71,973,816 D366Y probably damaging Het
Crnkl1 T A 2: 145,928,131 N264I probably benign Het
Ctnnd2 T C 15: 30,905,748 L847P probably damaging Het
Cyp4a31 A C 4: 115,571,348 T382P possibly damaging Het
Dcaf8 A T 1: 172,165,867 M1L probably benign Het
Ddx31 T A 2: 28,844,982 F52I probably benign Het
Eps15 G A 4: 109,382,866 S852N possibly damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Frem2 T C 3: 53,655,824 M421V probably benign Het
Gm1110 T G 9: 26,920,747 H36P probably benign Het
Gm11639 A T 11: 104,785,008 Y1542F probably benign Het
Hadha C T 5: 30,120,044 probably null Het
Hspa4 C T 11: 53,262,939 E702K probably benign Het
Intu C A 3: 40,675,326 T362K probably damaging Het
Jaml C T 9: 45,097,919 T248I probably damaging Het
Kcnj1 A T 9: 32,396,867 S176C probably damaging Het
Kcnj9 A G 1: 172,326,137 L140P probably damaging Het
Kif7 T C 7: 79,702,143 K957R probably damaging Het
Klc4 T A 17: 46,636,679 I366F probably damaging Het
Lamb2 A G 9: 108,488,199 probably null Het
Madd T C 2: 91,178,104 D151G probably benign Het
Man2a1 C A 17: 64,710,826 A689E probably damaging Het
Mapk8ip1 C A 2: 92,389,244 G81C probably damaging Het
Msmp T C 4: 43,583,909 Y48C probably damaging Het
Muc6 T C 7: 141,648,821 N567S probably damaging Het
Nrap A G 19: 56,354,221 Y748H probably damaging Het
Nrap C T 19: 56,379,875 A192T possibly damaging Het
Olfr1138 G C 2: 87,737,896 Q143E possibly damaging Het
Olfr1370 T A 13: 21,072,690 T204S possibly damaging Het
Olfr1384 T A 11: 49,514,165 F176I possibly damaging Het
Pcdhb8 T G 18: 37,357,169 D633E possibly damaging Het
Pcdhb9 G A 18: 37,403,154 V734M probably damaging Het
Plscr1 T C 9: 92,259,321 Y21H unknown Het
Ptk2b G T 14: 66,163,066 P767T probably damaging Het
Ptprz1 T C 6: 23,051,990 Y1424H probably damaging Het
Sec31a T A 5: 100,386,184 Q118L probably benign Het
Selenop A G 15: 3,274,734 S21G probably damaging Het
Shank1 G A 7: 44,352,253 S1132N unknown Het
Slf1 A G 13: 77,084,383 L534P probably damaging Het
Sparcl1 T A 5: 104,085,147 H596L probably damaging Het
Spocd1 C T 4: 129,957,108 probably null Het
Tbc1d24 A T 17: 24,185,993 I59N probably damaging Het
Tctex1d1 A G 4: 102,988,667 N32S probably benign Het
Tjp3 G A 10: 81,277,276 T580I probably benign Het
Tmem154 C T 3: 84,684,296 T51M possibly damaging Het
Tmem8b G A 4: 43,690,246 V894I probably benign Het
Trbv20 A T 6: 41,188,906 L88F possibly damaging Het
Tssk2 A C 16: 17,898,948 I72L possibly damaging Het
Tub T A 7: 109,027,058 I267N probably damaging Het
Vmn2r104 A T 17: 20,041,567 F434I possibly damaging Het
Vmn2r42 T C 7: 8,192,734 N471S probably damaging Het
Vmn2r94 C G 17: 18,258,123 G121R probably damaging Het
Wdr72 T C 9: 74,148,223 S245P probably damaging Het
Zbtb42 A G 12: 112,679,535 Y48C probably damaging Het
Zdbf2 T C 1: 63,304,433 V657A possibly damaging Het
Zfp768 A T 7: 127,344,091 C288* probably null Het
Zfp988 T A 4: 147,332,013 C301* probably null Het
Other mutations in Fchsd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00590:Fchsd1 APN 18 37965893 intron probably benign
IGL01097:Fchsd1 APN 18 37967757 splice site probably null
IGL02069:Fchsd1 APN 18 37967614 nonsense probably null
R0015:Fchsd1 UTSW 18 37962959 missense probably benign 0.05
R0015:Fchsd1 UTSW 18 37962959 missense probably benign 0.05
R0755:Fchsd1 UTSW 18 37968750 splice site probably null
R1524:Fchsd1 UTSW 18 37965897 critical splice donor site probably null
R2041:Fchsd1 UTSW 18 37967676 critical splice acceptor site probably null
R3820:Fchsd1 UTSW 18 37969457 splice site probably benign
R3821:Fchsd1 UTSW 18 37969457 splice site probably benign
R4998:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5017:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5018:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5022:Fchsd1 UTSW 18 37964810 missense possibly damaging 0.80
R5023:Fchsd1 UTSW 18 37964810 missense possibly damaging 0.80
R5047:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5240:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5309:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5312:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5353:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5354:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5355:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5424:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5517:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5518:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5521:Fchsd1 UTSW 18 37966484 missense probably damaging 1.00
R5590:Fchsd1 UTSW 18 37961327 missense probably damaging 1.00
R5607:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5608:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5810:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5828:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5906:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5949:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5958:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5969:Fchsd1 UTSW 18 37959873 unclassified probably benign
R6322:Fchsd1 UTSW 18 37965700 missense probably benign 0.00
R6433:Fchsd1 UTSW 18 37964084 missense possibly damaging 0.91
R6439:Fchsd1 UTSW 18 37969434 missense probably damaging 0.97
R6460:Fchsd1 UTSW 18 37959844 splice site probably null
R6488:Fchsd1 UTSW 18 37967268 splice site probably null
R6650:Fchsd1 UTSW 18 37966502 nonsense probably null
R7331:Fchsd1 UTSW 18 37968770 missense possibly damaging 0.95
R7715:Fchsd1 UTSW 18 37966642 splice site probably null
R7962:Fchsd1 UTSW 18 37964159 missense probably damaging 0.97
R8140:Fchsd1 UTSW 18 37964342 missense probably damaging 1.00
R8398:Fchsd1 UTSW 18 37966524 missense probably damaging 1.00
X0024:Fchsd1 UTSW 18 37969391 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGACCAAGCAGTTCCTCTAC -3'
(R):5'- TGTCCCTGAGCGATATCTCAAC -3'

Sequencing Primer
(F):5'- TCTACCAGGAGAGATGGGAAGACTC -3'
(R):5'- GAGCGATATCTCAACTTCCCGG -3'
Posted On2018-02-28