Incidental Mutation 'R6248:Etl4'
ID505572
Institutional Source Beutler Lab
Gene Symbol Etl4
Ensembl Gene ENSMUSG00000036617
Gene Nameenhancer trap locus 4
Synonyms6620402G01Rik, 9430077C05Rik, Skt, Sickle tail, E330027G05Rik, Etl-4
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.852) question?
Stock #R6248 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location19909780-20810713 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 20809089 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 1907 (T1907I)
Ref Sequence ENSEMBL: ENSMUSP00000066170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045555] [ENSMUST00000066509] [ENSMUST00000114604] [ENSMUST00000114606] [ENSMUST00000114607] [ENSMUST00000114608] [ENSMUST00000114614] [ENSMUST00000114627]
Predicted Effect probably benign
Transcript: ENSMUST00000045555
AA Change: T1313I

PolyPhen 2 Score 0.258 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000041431
Gene: ENSMUSG00000036617
AA Change: T1313I

DomainStartEndE-ValueType
Pfam:AIP3 188 291 1.7e-11 PFAM
low complexity region 313 328 N/A INTRINSIC
low complexity region 350 368 N/A INTRINSIC
coiled coil region 620 652 N/A INTRINSIC
low complexity region 1067 1096 N/A INTRINSIC
low complexity region 1212 1231 N/A INTRINSIC
low complexity region 1296 1314 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000066509
AA Change: T1907I

PolyPhen 2 Score 0.898 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000066170
Gene: ENSMUSG00000036617
AA Change: T1907I

DomainStartEndE-ValueType
low complexity region 313 328 N/A INTRINSIC
low complexity region 350 368 N/A INTRINSIC
coiled coil region 655 687 N/A INTRINSIC
low complexity region 1102 1131 N/A INTRINSIC
low complexity region 1372 1381 N/A INTRINSIC
low complexity region 1470 1495 N/A INTRINSIC
low complexity region 1571 1582 N/A INTRINSIC
coiled coil region 1658 1686 N/A INTRINSIC
low complexity region 1724 1737 N/A INTRINSIC
low complexity region 1806 1825 N/A INTRINSIC
low complexity region 1890 1908 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114604
AA Change: T1308I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000110251
Gene: ENSMUSG00000036617
AA Change: T1308I

DomainStartEndE-ValueType
Pfam:AIP3 188 291 1.7e-11 PFAM
low complexity region 313 328 N/A INTRINSIC
low complexity region 350 368 N/A INTRINSIC
coiled coil region 655 687 N/A INTRINSIC
low complexity region 1102 1131 N/A INTRINSIC
low complexity region 1207 1226 N/A INTRINSIC
low complexity region 1291 1309 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114606
SMART Domains Protein: ENSMUSP00000110253
Gene: ENSMUSG00000036617

DomainStartEndE-ValueType
low complexity region 31 46 N/A INTRINSIC
low complexity region 68 86 N/A INTRINSIC
coiled coil region 338 370 N/A INTRINSIC
low complexity region 785 814 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114607
SMART Domains Protein: ENSMUSP00000110254
Gene: ENSMUSG00000036617

DomainStartEndE-ValueType
low complexity region 31 46 N/A INTRINSIC
low complexity region 68 86 N/A INTRINSIC
coiled coil region 338 370 N/A INTRINSIC
low complexity region 785 814 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114608
AA Change: T1590I

PolyPhen 2 Score 0.793 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000110255
Gene: ENSMUSG00000036617
AA Change: T1590I

DomainStartEndE-ValueType
low complexity region 31 46 N/A INTRINSIC
low complexity region 68 86 N/A INTRINSIC
coiled coil region 338 370 N/A INTRINSIC
low complexity region 785 814 N/A INTRINSIC
low complexity region 1055 1064 N/A INTRINSIC
low complexity region 1153 1178 N/A INTRINSIC
low complexity region 1254 1265 N/A INTRINSIC
coiled coil region 1341 1369 N/A INTRINSIC
low complexity region 1407 1420 N/A INTRINSIC
low complexity region 1489 1508 N/A INTRINSIC
low complexity region 1573 1591 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114614
AA Change: T1302I

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000110261
Gene: ENSMUSG00000036617
AA Change: T1302I

DomainStartEndE-ValueType
Pfam:AIP3 188 291 1.7e-11 PFAM
low complexity region 313 328 N/A INTRINSIC
low complexity region 350 368 N/A INTRINSIC
coiled coil region 620 652 N/A INTRINSIC
low complexity region 1056 1085 N/A INTRINSIC
low complexity region 1201 1220 N/A INTRINSIC
low complexity region 1285 1303 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114627
AA Change: T1958I

PolyPhen 2 Score 0.699 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000110274
Gene: ENSMUSG00000036617
AA Change: T1958I

DomainStartEndE-ValueType
low complexity region 21 38 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
Pfam:AIP3 239 341 2.4e-14 PFAM
low complexity region 364 379 N/A INTRINSIC
low complexity region 401 419 N/A INTRINSIC
Pfam:AIP3 600 841 1.1e-12 PFAM
low complexity region 1153 1182 N/A INTRINSIC
low complexity region 1423 1432 N/A INTRINSIC
low complexity region 1521 1546 N/A INTRINSIC
low complexity region 1622 1633 N/A INTRINSIC
coiled coil region 1709 1737 N/A INTRINSIC
low complexity region 1775 1788 N/A INTRINSIC
low complexity region 1857 1876 N/A INTRINSIC
low complexity region 1941 1959 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139531
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156587
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 100% (92/92)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene-trapped allele display malformations of the notochord and caudal vertebrae and may exhibit caudal tail kinks. Mice homozygous for another gene-trapped allele have malformed caudal vertebrae and intervertebral disk abnormalities; about half display kinked tails. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik T C 1: 160,075,408 S83P possibly damaging Het
Actr10 A T 12: 70,952,959 E176D probably benign Het
Adcy3 G A 12: 4,208,662 probably null Het
AI429214 T A 8: 36,994,124 I142N probably damaging Het
Alox12 A G 11: 70,253,110 L148S probably damaging Het
Ank3 A G 10: 69,973,850 I1147V probably benign Het
Apoc2 C T 7: 19,673,568 V12I probably benign Het
Arap3 T C 18: 37,991,354 S311G probably benign Het
Arih2 G T 9: 108,611,642 H292Q probably damaging Het
Cdc14a A T 3: 116,308,194 D312E probably benign Het
Cdh12 T G 15: 21,237,714 W12G possibly damaging Het
Cisd2 A T 3: 135,408,855 N118K probably damaging Het
Cntnap5b A G 1: 100,072,102 Q195R probably benign Het
Cyp2r1 A G 7: 114,562,731 probably null Het
Cyp4f37 A G 17: 32,629,890 D244G possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dido1 T A 2: 180,660,255 H1952L probably damaging Het
Dnah10 T A 5: 124,794,219 probably null Het
Dnal4 T A 15: 79,762,513 M56L probably damaging Het
Emilin2 A G 17: 71,274,117 V538A probably benign Het
Eps8l2 A G 7: 141,342,102 D31G probably damaging Het
Erp44 A T 4: 48,219,479 L112* probably null Het
Exoc3 A G 13: 74,182,281 F510L probably benign Het
Fam114a2 G T 11: 57,493,116 T324K possibly damaging Het
Fer1l4 G A 2: 156,046,171 R465C probably damaging Het
Frmd4b A C 6: 97,459,212 S2R probably benign Het
Fscn1 A T 5: 142,961,023 D192V possibly damaging Het
Gm15922 C A 7: 3,736,338 E510D probably benign Het
Gm3486 T A 14: 41,484,515 *200C probably null Het
Gusb A T 5: 130,000,525 H138Q probably benign Het
Hdac9 A T 12: 34,528,294 M4K possibly damaging Het
Hhipl1 G T 12: 108,318,705 R439L probably benign Het
Hoxd9 A G 2: 74,698,636 E194G probably benign Het
Itgb1 A G 8: 128,722,421 S503G possibly damaging Het
Kcnt2 T A 1: 140,509,478 C500S probably damaging Het
Kdm7a G A 6: 39,147,049 S727L possibly damaging Het
Klhdc4 A G 8: 121,813,768 F92L probably damaging Het
Klrb1a A G 6: 128,619,174 V62A probably damaging Het
Krit1 A G 5: 3,813,032 probably null Het
Krt40 A G 11: 99,541,740 I150T possibly damaging Het
Larp4b A G 13: 9,158,702 T464A probably benign Het
Lrrc52 T G 1: 167,466,395 D107A probably damaging Het
Mapkap1 G T 2: 34,518,680 V35F probably damaging Het
Mccc1 A G 3: 35,990,164 V171A probably damaging Het
Metap1d A T 2: 71,515,760 R222* probably null Het
Mrgpre G A 7: 143,780,866 A300V probably benign Het
Mterf1b C A 5: 4,196,606 N82K probably benign Het
Myh9 C T 15: 77,785,222 W533* probably null Het
Myom2 A G 8: 15,098,472 probably null Het
Ncor1 G A 11: 62,366,982 P329S probably damaging Het
Nr2f1 T C 13: 78,196,492 probably benign Het
Olfr1348 A T 7: 6,501,676 C183* probably null Het
Olfr1361 A T 13: 21,659,074 I83N possibly damaging Het
Olfr417 T G 1: 174,369,670 V251G probably benign Het
Olfr47 C T 6: 43,235,904 Q99* probably null Het
Olfr551 T C 7: 102,588,030 T238A probably benign Het
Olfr800 A G 10: 129,660,663 I286V probably benign Het
Olfr96 T A 17: 37,225,560 L145* probably null Het
Pcdha11 T C 18: 37,005,897 L193P probably benign Het
Pcdhb20 T A 18: 37,506,232 F604I probably damaging Het
Pde1a T C 2: 79,878,201 H291R probably damaging Het
Pfkm G A 15: 98,126,379 V423M probably damaging Het
Pkd2l1 G T 19: 44,157,669 Q149K probably benign Het
Pkhd1l1 T A 15: 44,529,559 N1763K probably benign Het
Pla2g4a G A 1: 149,872,587 T282I probably damaging Het
Prpf39 A C 12: 65,042,754 N89H probably damaging Het
Rad54l2 A G 9: 106,710,338 F743L probably damaging Het
Raver2 A G 4: 101,134,123 probably null Het
Ric8b T C 10: 84,947,845 L189P probably damaging Het
Sccpdh T C 1: 179,668,392 F13L probably benign Het
Scd2 T C 19: 44,303,009 F296L probably damaging Het
Scg2 G T 1: 79,436,306 D233E probably benign Het
Sema5b C A 16: 35,628,007 probably null Het
Skint5 A T 4: 113,779,089 V644E unknown Het
Slc44a5 G T 3: 154,264,041 V612F possibly damaging Het
Snd1 C T 6: 28,520,235 R107* probably null Het
Sun5 G T 2: 153,860,669 T189K probably damaging Het
Tap1 A T 17: 34,193,177 E452V probably damaging Het
Tcam1 A G 11: 106,282,826 N32S probably benign Het
Tep1 T C 14: 50,830,258 E2167G probably damaging Het
Tm9sf1 C T 14: 55,636,370 R557H probably damaging Het
Tmem175 T C 5: 108,645,955 V317A probably damaging Het
Tsga13 A G 6: 30,897,204 V231A probably benign Het
Tspan12 A G 6: 21,799,971 S126P probably damaging Het
Uvrag G T 7: 98,988,191 D143E probably damaging Het
Vmn1r230 T A 17: 20,846,774 M75K possibly damaging Het
Vmn2r120 A T 17: 57,545,287 F10I probably benign Het
Vmn2r57 T C 7: 41,399,860 T822A probably benign Het
Vmn2r67 T C 7: 85,150,560 Y490C probably damaging Het
Zc3h7b T A 15: 81,783,185 W644R probably damaging Het
Zeb1 A G 18: 5,766,962 D491G probably damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Zfp831 A T 2: 174,644,515 T328S possibly damaging Het
Other mutations in Etl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00907:Etl4 APN 2 20766478 missense possibly damaging 0.81
IGL00944:Etl4 APN 2 20530054 missense possibly damaging 0.52
IGL01078:Etl4 APN 2 20806531 nonsense probably null
IGL01099:Etl4 APN 2 20807111 missense probably benign 0.06
IGL01337:Etl4 APN 2 20785387 missense probably benign 0.01
IGL01348:Etl4 APN 2 20806973 missense probably damaging 1.00
IGL01349:Etl4 APN 2 20713396 missense probably damaging 1.00
IGL01407:Etl4 APN 2 20743856 missense probably damaging 0.99
IGL01552:Etl4 APN 2 20778189 missense probably damaging 0.99
IGL01662:Etl4 APN 2 20806649 missense probably benign 0.04
IGL01687:Etl4 APN 2 20530087 missense probably damaging 1.00
IGL01793:Etl4 APN 2 20743898 missense possibly damaging 0.87
IGL01844:Etl4 APN 2 20806682 missense probably benign 0.06
IGL02025:Etl4 APN 2 20806526 missense probably damaging 1.00
IGL02088:Etl4 APN 2 20806548 missense probably damaging 1.00
IGL02134:Etl4 APN 2 20806429 missense possibly damaging 0.79
IGL02369:Etl4 APN 2 20530189 missense probably damaging 1.00
IGL02480:Etl4 APN 2 20788524 missense probably damaging 0.99
IGL02560:Etl4 APN 2 20743718 missense probably damaging 1.00
IGL02851:Etl4 APN 2 20808029 missense possibly damaging 0.46
IGL02893:Etl4 APN 2 20760210 splice site probably benign
IGL02951:Etl4 APN 2 20801537 splice site probably benign
IGL03119:Etl4 APN 2 20713387 missense probably damaging 1.00
IGL03267:Etl4 APN 2 20785182 nonsense probably null
IGL03379:Etl4 APN 2 20662016 missense possibly damaging 0.87
R0038:Etl4 UTSW 2 20743574 missense probably damaging 1.00
R0038:Etl4 UTSW 2 20743574 missense probably damaging 1.00
R0095:Etl4 UTSW 2 20743868 missense probably damaging 1.00
R0100:Etl4 UTSW 2 20339905 missense probably benign
R0311:Etl4 UTSW 2 20807129 missense probably damaging 1.00
R0346:Etl4 UTSW 2 20759652 critical splice donor site probably null
R0348:Etl4 UTSW 2 20778129 missense probably damaging 1.00
R0379:Etl4 UTSW 2 20807354 missense probably damaging 0.98
R0571:Etl4 UTSW 2 20743769 missense probably damaging 0.99
R0697:Etl4 UTSW 2 20743861 missense probably damaging 1.00
R0707:Etl4 UTSW 2 20805571 splice site probably benign
R0980:Etl4 UTSW 2 20801567 missense probably damaging 1.00
R1120:Etl4 UTSW 2 20806703 missense probably benign 0.00
R1254:Etl4 UTSW 2 20807923 missense probably damaging 1.00
R1346:Etl4 UTSW 2 20806144 missense possibly damaging 0.94
R1460:Etl4 UTSW 2 20788477 missense probably damaging 1.00
R1503:Etl4 UTSW 2 20743874 missense possibly damaging 0.94
R1547:Etl4 UTSW 2 20785228 missense probably damaging 1.00
R1627:Etl4 UTSW 2 20801579 missense possibly damaging 0.91
R1635:Etl4 UTSW 2 20806408 missense probably damaging 1.00
R1716:Etl4 UTSW 2 20743681 missense probably damaging 1.00
R1795:Etl4 UTSW 2 20808026 critical splice donor site probably null
R1885:Etl4 UTSW 2 20743984 missense probably damaging 1.00
R2039:Etl4 UTSW 2 20785228 missense probably damaging 1.00
R2083:Etl4 UTSW 2 20743549 missense probably damaging 1.00
R2109:Etl4 UTSW 2 20785342 missense probably benign 0.27
R2153:Etl4 UTSW 2 20798734 missense probably benign 0.00
R2403:Etl4 UTSW 2 20807306 nonsense probably null
R2883:Etl4 UTSW 2 20806174 missense possibly damaging 0.83
R2985:Etl4 UTSW 2 20781849 missense probably damaging 1.00
R3402:Etl4 UTSW 2 20781882 missense probably damaging 1.00
R3696:Etl4 UTSW 2 20801662 critical splice donor site probably null
R3755:Etl4 UTSW 2 20743537 missense probably benign 0.10
R3813:Etl4 UTSW 2 20788435 missense probably damaging 1.00
R3829:Etl4 UTSW 2 20785421 missense probably benign 0.07
R3887:Etl4 UTSW 2 20529961 nonsense probably null
R3888:Etl4 UTSW 2 20529961 nonsense probably null
R3889:Etl4 UTSW 2 20529961 nonsense probably null
R3958:Etl4 UTSW 2 20340043 missense probably benign
R3959:Etl4 UTSW 2 20340043 missense probably benign
R3960:Etl4 UTSW 2 20340043 missense probably benign
R4058:Etl4 UTSW 2 20806019 missense possibly damaging 0.59
R4074:Etl4 UTSW 2 20809219 utr 3 prime probably benign
R4077:Etl4 UTSW 2 20807961 missense probably damaging 1.00
R4078:Etl4 UTSW 2 20807961 missense probably damaging 1.00
R4127:Etl4 UTSW 2 20744075 missense possibly damaging 0.93
R4200:Etl4 UTSW 2 20781883 missense probably damaging 1.00
R4492:Etl4 UTSW 2 20806865 missense possibly damaging 0.67
R4514:Etl4 UTSW 2 20661898 missense probably damaging 1.00
R4820:Etl4 UTSW 2 20806685 missense possibly damaging 0.85
R4825:Etl4 UTSW 2 20806927 missense probably damaging 1.00
R4888:Etl4 UTSW 2 20340111 critical splice donor site probably null
R4938:Etl4 UTSW 2 20798649 missense probably benign 0.00
R4943:Etl4 UTSW 2 20807281 missense probably benign 0.05
R5121:Etl4 UTSW 2 20340111 critical splice donor site probably null
R5191:Etl4 UTSW 2 20339999 missense probably damaging 0.99
R5198:Etl4 UTSW 2 20713387 missense probably damaging 1.00
R5199:Etl4 UTSW 2 20744042 missense probably damaging 1.00
R5470:Etl4 UTSW 2 20529980 missense probably damaging 0.99
R5513:Etl4 UTSW 2 20743827 missense probably damaging 1.00
R5620:Etl4 UTSW 2 20530226 missense probably damaging 1.00
R5635:Etl4 UTSW 2 20807035 missense probably damaging 1.00
R5641:Etl4 UTSW 2 20806462 frame shift probably null
R5690:Etl4 UTSW 2 20805836 missense probably benign 0.01
R5784:Etl4 UTSW 2 20806205 missense possibly damaging 0.79
R5794:Etl4 UTSW 2 20806512 missense probably damaging 1.00
R5908:Etl4 UTSW 2 20743907 missense probably damaging 0.96
R5982:Etl4 UTSW 2 20781015 missense probably damaging 1.00
R6151:Etl4 UTSW 2 20713360 missense probably damaging 1.00
R6192:Etl4 UTSW 2 20801551 missense probably damaging 0.98
R6238:Etl4 UTSW 2 20801568 missense probably damaging 1.00
R6292:Etl4 UTSW 2 20743573 missense probably damaging 1.00
R6610:Etl4 UTSW 2 20713369 missense probably damaging 1.00
R6739:Etl4 UTSW 2 20713435 missense probably damaging 1.00
R6846:Etl4 UTSW 2 20744108 missense possibly damaging 0.94
R6863:Etl4 UTSW 2 20806309 missense probably benign 0.01
R6873:Etl4 UTSW 2 20797992 synonymous probably null
R7003:Etl4 UTSW 2 20805884 missense probably benign 0.03
R7155:Etl4 UTSW 2 20806931 missense probably damaging 0.96
R7207:Etl4 UTSW 2 20709576 missense probably damaging 0.99
R7230:Etl4 UTSW 2 20797988 missense probably damaging 1.00
R7305:Etl4 UTSW 2 20709557 missense probably damaging 1.00
R7389:Etl4 UTSW 2 20785093 nonsense probably null
R7396:Etl4 UTSW 2 20798638 missense possibly damaging 0.62
R7441:Etl4 UTSW 2 20744189 missense possibly damaging 0.87
R7626:Etl4 UTSW 2 20713378 missense probably damaging 1.00
X0018:Etl4 UTSW 2 20809190 missense probably damaging 0.98
X0022:Etl4 UTSW 2 20709564 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACCATCGATTGCTTCTACCC -3'
(R):5'- AAACACTTGTTCCAGATTGCTG -3'

Sequencing Primer
(F):5'- TCTCAGCCCCCAAGCAGG -3'
(R):5'- TGCTGAAAATTAAAAACAAGGATGC -3'
Posted On2018-02-28