Incidental Mutation 'R6248:Myom2'
ID505608
Institutional Source Beutler Lab
Gene Symbol Myom2
Ensembl Gene ENSMUSG00000031461
Gene Namemyomesin 2
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R6248 (G1)
Quality Score209.009
Status Validated
Chromosome8
Chromosomal Location15057653-15133541 bp(+) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) A to G at 15098472 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000033842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033842]
Predicted Effect probably null
Transcript: ENSMUST00000033842
SMART Domains Protein: ENSMUSP00000033842
Gene: ENSMUSG00000031461

DomainStartEndE-ValueType
low complexity region 34 63 N/A INTRINSIC
low complexity region 79 87 N/A INTRINSIC
coiled coil region 97 129 N/A INTRINSIC
IG 160 247 7.7e-5 SMART
IG 284 373 8.01e-3 SMART
FN3 383 466 1.5e-14 SMART
FN3 511 594 1.79e-12 SMART
FN3 612 693 1.95e-13 SMART
FN3 711 794 8.69e-11 SMART
FN3 813 896 1.86e-10 SMART
IG_like 913 999 1.58e2 SMART
Blast:IG_like 1021 1106 1e-44 BLAST
IG_like 1135 1215 2.27e1 SMART
Blast:IG_like 1227 1321 9e-51 BLAST
IGc2 1357 1425 4.96e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117573
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 100% (92/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The giant protein titin, together with its associated proteins, interconnects the major structure of sarcomeres, the M bands and Z discs. The C-terminal end of the titin string extends into the M line, where it binds tightly to M-band constituents of apparent molecular masses of 190 kD and 165 kD. The predicted MYOM2 protein contains 1,465 amino acids. Like MYOM1, MYOM2 has a unique N-terminal domain followed by 12 repeat domains with strong homology to either fibronectin type III or immunoglobulin C2 domains. Protein sequence comparisons suggested that the MYOM2 protein and bovine M protein are identical. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik T C 1: 160,075,408 S83P possibly damaging Het
Actr10 A T 12: 70,952,959 E176D probably benign Het
Adcy3 G A 12: 4,208,662 probably null Het
AI429214 T A 8: 36,994,124 I142N probably damaging Het
Alox12 A G 11: 70,253,110 L148S probably damaging Het
Ank3 A G 10: 69,973,850 I1147V probably benign Het
Apoc2 C T 7: 19,673,568 V12I probably benign Het
Arap3 T C 18: 37,991,354 S311G probably benign Het
Arih2 G T 9: 108,611,642 H292Q probably damaging Het
Cdc14a A T 3: 116,308,194 D312E probably benign Het
Cdh12 T G 15: 21,237,714 W12G possibly damaging Het
Cisd2 A T 3: 135,408,855 N118K probably damaging Het
Cntnap5b A G 1: 100,072,102 Q195R probably benign Het
Cyp2r1 A G 7: 114,562,731 probably null Het
Cyp4f37 A G 17: 32,629,890 D244G possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dido1 T A 2: 180,660,255 H1952L probably damaging Het
Dnah10 T A 5: 124,794,219 probably null Het
Dnal4 T A 15: 79,762,513 M56L probably damaging Het
Emilin2 A G 17: 71,274,117 V538A probably benign Het
Eps8l2 A G 7: 141,342,102 D31G probably damaging Het
Erp44 A T 4: 48,219,479 L112* probably null Het
Etl4 C T 2: 20,809,089 T1907I possibly damaging Het
Exoc3 A G 13: 74,182,281 F510L probably benign Het
Fam114a2 G T 11: 57,493,116 T324K possibly damaging Het
Fer1l4 G A 2: 156,046,171 R465C probably damaging Het
Frmd4b A C 6: 97,459,212 S2R probably benign Het
Fscn1 A T 5: 142,961,023 D192V possibly damaging Het
Gm15922 C A 7: 3,736,338 E510D probably benign Het
Gm3486 T A 14: 41,484,515 *200C probably null Het
Gusb A T 5: 130,000,525 H138Q probably benign Het
Hdac9 A T 12: 34,528,294 M4K possibly damaging Het
Hhipl1 G T 12: 108,318,705 R439L probably benign Het
Hoxd9 A G 2: 74,698,636 E194G probably benign Het
Itgb1 A G 8: 128,722,421 S503G possibly damaging Het
Kcnt2 T A 1: 140,509,478 C500S probably damaging Het
Kdm7a G A 6: 39,147,049 S727L possibly damaging Het
Klhdc4 A G 8: 121,813,768 F92L probably damaging Het
Klrb1a A G 6: 128,619,174 V62A probably damaging Het
Krit1 A G 5: 3,813,032 probably null Het
Krt40 A G 11: 99,541,740 I150T possibly damaging Het
Larp4b A G 13: 9,158,702 T464A probably benign Het
Lrrc52 T G 1: 167,466,395 D107A probably damaging Het
Mapkap1 G T 2: 34,518,680 V35F probably damaging Het
Mccc1 A G 3: 35,990,164 V171A probably damaging Het
Metap1d A T 2: 71,515,760 R222* probably null Het
Mrgpre G A 7: 143,780,866 A300V probably benign Het
Mterf1b C A 5: 4,196,606 N82K probably benign Het
Myh9 C T 15: 77,785,222 W533* probably null Het
Ncor1 G A 11: 62,366,982 P329S probably damaging Het
Nr2f1 T C 13: 78,196,492 probably benign Het
Olfr1348 A T 7: 6,501,676 C183* probably null Het
Olfr1361 A T 13: 21,659,074 I83N possibly damaging Het
Olfr417 T G 1: 174,369,670 V251G probably benign Het
Olfr47 C T 6: 43,235,904 Q99* probably null Het
Olfr551 T C 7: 102,588,030 T238A probably benign Het
Olfr800 A G 10: 129,660,663 I286V probably benign Het
Olfr96 T A 17: 37,225,560 L145* probably null Het
Pcdha11 T C 18: 37,005,897 L193P probably benign Het
Pcdhb20 T A 18: 37,506,232 F604I probably damaging Het
Pde1a T C 2: 79,878,201 H291R probably damaging Het
Pfkm G A 15: 98,126,379 V423M probably damaging Het
Pkd2l1 G T 19: 44,157,669 Q149K probably benign Het
Pkhd1l1 T A 15: 44,529,559 N1763K probably benign Het
Pla2g4a G A 1: 149,872,587 T282I probably damaging Het
Prpf39 A C 12: 65,042,754 N89H probably damaging Het
Rad54l2 A G 9: 106,710,338 F743L probably damaging Het
Raver2 A G 4: 101,134,123 probably null Het
Ric8b T C 10: 84,947,845 L189P probably damaging Het
Sccpdh T C 1: 179,668,392 F13L probably benign Het
Scd2 T C 19: 44,303,009 F296L probably damaging Het
Scg2 G T 1: 79,436,306 D233E probably benign Het
Sema5b C A 16: 35,628,007 probably null Het
Skint5 A T 4: 113,779,089 V644E unknown Het
Slc44a5 G T 3: 154,264,041 V612F possibly damaging Het
Snd1 C T 6: 28,520,235 R107* probably null Het
Sun5 G T 2: 153,860,669 T189K probably damaging Het
Tap1 A T 17: 34,193,177 E452V probably damaging Het
Tcam1 A G 11: 106,282,826 N32S probably benign Het
Tep1 T C 14: 50,830,258 E2167G probably damaging Het
Tm9sf1 C T 14: 55,636,370 R557H probably damaging Het
Tmem175 T C 5: 108,645,955 V317A probably damaging Het
Tsga13 A G 6: 30,897,204 V231A probably benign Het
Tspan12 A G 6: 21,799,971 S126P probably damaging Het
Uvrag G T 7: 98,988,191 D143E probably damaging Het
Vmn1r230 T A 17: 20,846,774 M75K possibly damaging Het
Vmn2r120 A T 17: 57,545,287 F10I probably benign Het
Vmn2r57 T C 7: 41,399,860 T822A probably benign Het
Vmn2r67 T C 7: 85,150,560 Y490C probably damaging Het
Zc3h7b T A 15: 81,783,185 W644R probably damaging Het
Zeb1 A G 18: 5,766,962 D491G probably damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Zfp831 A T 2: 174,644,515 T328S possibly damaging Het
Other mutations in Myom2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Myom2 APN 8 15069490 missense probably damaging 1.00
IGL00426:Myom2 APN 8 15069502 missense probably benign 0.00
IGL00503:Myom2 APN 8 15114289 splice site probably null
IGL01515:Myom2 APN 8 15122655 missense probably benign 0.15
IGL01649:Myom2 APN 8 15113755 missense probably benign 0.24
IGL01658:Myom2 APN 8 15077880 missense probably damaging 1.00
IGL01786:Myom2 APN 8 15106330 missense probably damaging 0.99
IGL01924:Myom2 APN 8 15069685 missense probably benign 0.37
IGL01929:Myom2 APN 8 15117698 missense probably damaging 0.96
IGL02016:Myom2 APN 8 15125195 missense probably benign 0.01
IGL02511:Myom2 APN 8 15065743 missense probably benign
IGL02558:Myom2 APN 8 15114237 missense probably benign 0.31
IGL02944:Myom2 APN 8 15104065 critical splice acceptor site probably null
IGL03052:Myom2 APN 8 15123442 splice site probably benign
IGL03195:Myom2 APN 8 15111844 nonsense probably null
IGL03288:Myom2 APN 8 15122679 missense probably damaging 0.99
IGL03402:Myom2 APN 8 15065731 missense probably benign
R0069:Myom2 UTSW 8 15117624 missense probably benign
R0116:Myom2 UTSW 8 15117633 missense probably damaging 1.00
R0131:Myom2 UTSW 8 15083329 missense probably damaging 0.98
R0373:Myom2 UTSW 8 15098419 missense possibly damaging 0.91
R0463:Myom2 UTSW 8 15104123 missense probably benign 0.09
R0544:Myom2 UTSW 8 15069796 missense probably damaging 1.00
R0629:Myom2 UTSW 8 15069783 missense probably damaging 0.98
R0634:Myom2 UTSW 8 15119216 splice site probably benign
R0645:Myom2 UTSW 8 15117698 missense probably damaging 0.96
R0730:Myom2 UTSW 8 15099326 missense probably benign 0.00
R0744:Myom2 UTSW 8 15132924 nonsense probably null
R0836:Myom2 UTSW 8 15132924 nonsense probably null
R1033:Myom2 UTSW 8 15108934 missense probably benign 0.04
R1103:Myom2 UTSW 8 15110827 missense probably benign 0.22
R1110:Myom2 UTSW 8 15122413 missense probably benign 0.44
R1208:Myom2 UTSW 8 15084631 missense probably damaging 1.00
R1208:Myom2 UTSW 8 15084631 missense probably damaging 1.00
R1353:Myom2 UTSW 8 15106424 missense probably damaging 1.00
R1530:Myom2 UTSW 8 15122384 missense probably damaging 1.00
R1544:Myom2 UTSW 8 15104059 splice site probably benign
R1576:Myom2 UTSW 8 15084556 missense probably damaging 1.00
R1758:Myom2 UTSW 8 15065795 missense probably benign 0.00
R1884:Myom2 UTSW 8 15114278 missense probably benign 0.01
R1908:Myom2 UTSW 8 15081023 missense probably damaging 1.00
R1962:Myom2 UTSW 8 15132599 intron probably null
R1977:Myom2 UTSW 8 15085263 missense possibly damaging 0.47
R2018:Myom2 UTSW 8 15131151 missense probably damaging 1.00
R2049:Myom2 UTSW 8 15106379 missense probably damaging 0.97
R2155:Myom2 UTSW 8 15084555 missense probably damaging 0.98
R2314:Myom2 UTSW 8 15063927 missense probably damaging 0.99
R2350:Myom2 UTSW 8 15108835 missense probably benign 0.09
R2358:Myom2 UTSW 8 15112018 missense possibly damaging 0.68
R2904:Myom2 UTSW 8 15098348 missense probably benign 0.00
R3418:Myom2 UTSW 8 15085294 missense probably benign 0.01
R3606:Myom2 UTSW 8 15069775 missense probably damaging 1.00
R3607:Myom2 UTSW 8 15069775 missense probably damaging 1.00
R3735:Myom2 UTSW 8 15069676 missense probably benign 0.01
R3756:Myom2 UTSW 8 15102650 missense probably benign 0.11
R3902:Myom2 UTSW 8 15104165 missense probably benign
R3951:Myom2 UTSW 8 15084556 missense probably benign 0.35
R4240:Myom2 UTSW 8 15132895 missense probably benign 0.10
R4361:Myom2 UTSW 8 15112018 missense possibly damaging 0.68
R4581:Myom2 UTSW 8 15106459 missense probably benign 0.02
R4736:Myom2 UTSW 8 15081271 missense probably damaging 0.99
R5010:Myom2 UTSW 8 15083310 missense probably damaging 0.98
R5108:Myom2 UTSW 8 15132667 missense probably damaging 0.99
R5370:Myom2 UTSW 8 15099343 missense probably benign 0.10
R5427:Myom2 UTSW 8 15113764 missense probably benign 0.03
R5498:Myom2 UTSW 8 15129142 missense probably benign 0.01
R5504:Myom2 UTSW 8 15128879 missense probably damaging 1.00
R5567:Myom2 UTSW 8 15102546 missense probably benign 0.01
R5743:Myom2 UTSW 8 15080914 missense possibly damaging 0.82
R5745:Myom2 UTSW 8 15122705 missense probably benign 0.01
R5844:Myom2 UTSW 8 15131182 critical splice donor site probably null
R5854:Myom2 UTSW 8 15108478 missense probably benign
R6141:Myom2 UTSW 8 15063903 missense probably damaging 1.00
R6209:Myom2 UTSW 8 15104173 missense possibly damaging 0.76
R6378:Myom2 UTSW 8 15099356 missense probably benign 0.11
R6829:Myom2 UTSW 8 15122643 nonsense probably null
R6913:Myom2 UTSW 8 15065710 missense probably benign
R6957:Myom2 UTSW 8 15117741 missense probably null 0.42
R6958:Myom2 UTSW 8 15117741 missense probably null 0.42
R6960:Myom2 UTSW 8 15117741 missense probably null 0.42
R6961:Myom2 UTSW 8 15117741 missense probably null 0.42
R6962:Myom2 UTSW 8 15117741 missense probably null 0.42
R6999:Myom2 UTSW 8 15084531 missense probably benign 0.22
R7148:Myom2 UTSW 8 15084577 missense possibly damaging 0.72
R7210:Myom2 UTSW 8 15104114 missense probably damaging 1.00
R7298:Myom2 UTSW 8 15098411 missense probably damaging 1.00
R7463:Myom2 UTSW 8 15117679 missense probably null 0.94
R7535:Myom2 UTSW 8 15117679 missense probably damaging 1.00
R7573:Myom2 UTSW 8 15122450 missense probably damaging 1.00
R7590:Myom2 UTSW 8 15117679 missense probably damaging 1.00
R7690:Myom2 UTSW 8 15111717 critical splice acceptor site probably null
R7794:Myom2 UTSW 8 15083259 missense probably damaging 1.00
R7822:Myom2 UTSW 8 15108454 missense probably benign
R7948:Myom2 UTSW 8 15085306 missense probably benign 0.00
R8094:Myom2 UTSW 8 15069418 missense possibly damaging 0.94
R8268:Myom2 UTSW 8 15129157 missense probably damaging 1.00
R8292:Myom2 UTSW 8 15132888 missense probably benign 0.01
RF001:Myom2 UTSW 8 15081418 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- ATCAGAACAGACCTGGACTCCG -3'
(R):5'- CATGCAAACACTGAGCACTG -3'

Sequencing Primer
(F):5'- GAGTGCTAAGTGTCCCCATACAG -3'
(R):5'- GCACTGACAGGACCTGCATTTC -3'
Posted On2018-02-28