Mutagenetix > Incidental Mutation

Incidental Mutation 'R6248:Hhipl1'

505627

Institutional Source

Beutler Lab

Gene Symbol

Hhipl1

Ensembl Gene

ENSMUSG00000021260

Gene Name

hedgehog interacting protein-like 1

Synonyms

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6248 (G1)

Quality Score

178.009

Status

Validated

Chromosome

Chromosomal Location

108306270-108330869 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 108318705 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 439 (R439L)

Ref Sequence

ENSEMBL: ENSMUSP00000021685 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021685]

AlphaFold

Q14DK5

Predicted Effect

probably benign
Transcript: ENSMUST00000021685
AA Change: R439L

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000021685
Gene: ENSMUSG00000021260
AA Change: R439L

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:Folate_rec	28	189	2.4e-21	PFAM
Pfam:GSDH	199	532	3e-39	PFAM
low complexity region	619	670	N/A	INTRINSIC
SR	682	785	2.01e-47	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000181875

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223395

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.2%

Validation Efficiency

100% (92/92)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the glucose/sorbosone dehydrogenase family. The encoded protein also contains a domain that binds folate and reduced folic acid derivatives. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930523C07Rik	T	C	1: 160,075,408	S83P	possibly damaging	Het
Actr10	A	T	12: 70,952,959	E176D	probably benign	Het
Adcy3	G	A	12: 4,208,662		probably null	Het
AI429214	T	A	8: 36,994,124	I142N	probably damaging	Het
Alox12	A	G	11: 70,253,110	L148S	probably damaging	Het
Ank3	A	G	10: 69,973,850	I1147V	probably benign	Het
Apoc2	C	T	7: 19,673,568	V12I	probably benign	Het
Arap3	T	C	18: 37,991,354	S311G	probably benign	Het
Arih2	G	T	9: 108,611,642	H292Q	probably damaging	Het
Cdc14a	A	T	3: 116,308,194	D312E	probably benign	Het
Cdh12	T	G	15: 21,237,714	W12G	possibly damaging	Het
Cisd2	A	T	3: 135,408,855	N118K	probably damaging	Het
Cntnap5b	A	G	1: 100,072,102	Q195R	probably benign	Het
Cyp2r1	A	G	7: 114,562,731		probably null	Het
Cyp4f37	A	G	17: 32,629,890	D244G	possibly damaging	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Dido1	T	A	2: 180,660,255	H1952L	probably damaging	Het
Dnah10	T	A	5: 124,794,219		probably null	Het
Dnal4	T	A	15: 79,762,513	M56L	probably damaging	Het
Emilin2	A	G	17: 71,274,117	V538A	probably benign	Het
Eps8l2	A	G	7: 141,342,102	D31G	probably damaging	Het
Erp44	A	T	4: 48,219,479	L112*	probably null	Het
Etl4	C	T	2: 20,809,089	T1907I	possibly damaging	Het
Exoc3	A	G	13: 74,182,281	F510L	probably benign	Het
Fam114a2	G	T	11: 57,493,116	T324K	possibly damaging	Het
Fer1l4	G	A	2: 156,046,171	R465C	probably damaging	Het
Frmd4b	A	C	6: 97,459,212	S2R	probably benign	Het
Fscn1	A	T	5: 142,961,023	D192V	possibly damaging	Het
Gm15922	C	A	7: 3,736,338	E510D	probably benign	Het
Gm3486	T	A	14: 41,484,515	*200C	probably null	Het
Gusb	A	T	5: 130,000,525	H138Q	probably benign	Het
Hdac9	A	T	12: 34,528,294	M4K	possibly damaging	Het
Hoxd9	A	G	2: 74,698,636	E194G	probably benign	Het
Itgb1	A	G	8: 128,722,421	S503G	possibly damaging	Het
Kcnt2	T	A	1: 140,509,478	C500S	probably damaging	Het
Kdm7a	G	A	6: 39,147,049	S727L	possibly damaging	Het
Klhdc4	A	G	8: 121,813,768	F92L	probably damaging	Het
Klrb1a	A	G	6: 128,619,174	V62A	probably damaging	Het
Krit1	A	G	5: 3,813,032		probably null	Het
Krt40	A	G	11: 99,541,740	I150T	possibly damaging	Het
Larp4b	A	G	13: 9,158,702	T464A	probably benign	Het
Lrrc52	T	G	1: 167,466,395	D107A	probably damaging	Het
Mapkap1	G	T	2: 34,518,680	V35F	probably damaging	Het
Mccc1	A	G	3: 35,990,164	V171A	probably damaging	Het
Metap1d	A	T	2: 71,515,760	R222*	probably null	Het
Mrgpre	G	A	7: 143,780,866	A300V	probably benign	Het
Mterf1b	C	A	5: 4,196,606	N82K	probably benign	Het
Myh9	C	T	15: 77,785,222	W533*	probably null	Het
Myom2	A	G	8: 15,098,472		probably null	Het
Ncor1	G	A	11: 62,366,982	P329S	probably damaging	Het
Nr2f1	T	C	13: 78,196,492		probably benign	Het
Olfr1348	A	T	7: 6,501,676	C183*	probably null	Het
Olfr1361	A	T	13: 21,659,074	I83N	possibly damaging	Het
Olfr417	T	G	1: 174,369,670	V251G	probably benign	Het
Olfr47	C	T	6: 43,235,904	Q99*	probably null	Het
Olfr551	T	C	7: 102,588,030	T238A	probably benign	Het
Olfr800	A	G	10: 129,660,663	I286V	probably benign	Het
Olfr96	T	A	17: 37,225,560	L145*	probably null	Het
Pcdha11	T	C	18: 37,005,897	L193P	probably benign	Het
Pcdhb20	T	A	18: 37,506,232	F604I	probably damaging	Het
Pde1a	T	C	2: 79,878,201	H291R	probably damaging	Het
Pfkm	G	A	15: 98,126,379	V423M	probably damaging	Het
Pkd2l1	G	T	19: 44,157,669	Q149K	probably benign	Het
Pkhd1l1	T	A	15: 44,529,559	N1763K	probably benign	Het
Pla2g4a	G	A	1: 149,872,587	T282I	probably damaging	Het
Prpf39	A	C	12: 65,042,754	N89H	probably damaging	Het
Rad54l2	A	G	9: 106,710,338	F743L	probably damaging	Het
Raver2	A	G	4: 101,134,123		probably null	Het
Ric8b	T	C	10: 84,947,845	L189P	probably damaging	Het
Sccpdh	T	C	1: 179,668,392	F13L	probably benign	Het
Scd2	T	C	19: 44,303,009	F296L	probably damaging	Het
Scg2	G	T	1: 79,436,306	D233E	probably benign	Het
Sema5b	C	A	16: 35,628,007		probably null	Het
Skint5	A	T	4: 113,779,089	V644E	unknown	Het
Slc44a5	G	T	3: 154,264,041	V612F	possibly damaging	Het
Snd1	C	T	6: 28,520,235	R107*	probably null	Het
Sun5	G	T	2: 153,860,669	T189K	probably damaging	Het
Tap1	A	T	17: 34,193,177	E452V	probably damaging	Het
Tcam1	A	G	11: 106,282,826	N32S	probably benign	Het
Tep1	T	C	14: 50,830,258	E2167G	probably damaging	Het
Tm9sf1	C	T	14: 55,636,370	R557H	probably damaging	Het
Tmem175	T	C	5: 108,645,955	V317A	probably damaging	Het
Tsga13	A	G	6: 30,897,204	V231A	probably benign	Het
Tspan12	A	G	6: 21,799,971	S126P	probably damaging	Het
Uvrag	G	T	7: 98,988,191	D143E	probably damaging	Het
Vmn1r230	T	A	17: 20,846,774	M75K	possibly damaging	Het
Vmn2r120	A	T	17: 57,545,287	F10I	probably benign	Het
Vmn2r57	T	C	7: 41,399,860	T822A	probably benign	Het
Vmn2r67	T	C	7: 85,150,560	Y490C	probably damaging	Het
Zc3h7b	T	A	15: 81,783,185	W644R	probably damaging	Het
Zeb1	A	G	18: 5,766,962	D491G	probably damaging	Het
Zfp709	TCGACG	TCG	8: 71,890,708		probably benign	Het
Zfp831	A	T	2: 174,644,515	T328S	possibly damaging	Het

Other mutations in Hhipl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
lemon_drops	UTSW	12	108311944	missense	probably damaging	1.00
R1474_Hhipl1_947	UTSW	12	108311737	missense	probably damaging	1.00
Rock_candy	UTSW	12	108311689	missense	probably damaging	1.00
R0091:Hhipl1	UTSW	12	108321897	splice site	probably benign
R0180:Hhipl1	UTSW	12	108328070	missense	probably damaging	1.00
R0610:Hhipl1	UTSW	12	108319402	nonsense	probably null
R0962:Hhipl1	UTSW	12	108327721	missense	probably benign	0.02
R1170:Hhipl1	UTSW	12	108311693	nonsense	probably null
R1474:Hhipl1	UTSW	12	108311737	missense	probably damaging	1.00
R1878:Hhipl1	UTSW	12	108320060	missense	possibly damaging	0.93
R2001:Hhipl1	UTSW	12	108321859	missense	possibly damaging	0.90
R2103:Hhipl1	UTSW	12	108327718	missense	probably benign	0.04
R2132:Hhipl1	UTSW	12	108311690	missense	probably damaging	1.00
R2342:Hhipl1	UTSW	12	108318462	missense	probably damaging	1.00
R2408:Hhipl1	UTSW	12	108318547	missense	probably benign	0.05
R3431:Hhipl1	UTSW	12	108311689	missense	probably damaging	1.00
R3432:Hhipl1	UTSW	12	108311689	missense	probably damaging	1.00
R3741:Hhipl1	UTSW	12	108318717	missense	probably damaging	1.00
R3802:Hhipl1	UTSW	12	108312307	missense	probably benign
R4744:Hhipl1	UTSW	12	108319979	missense	possibly damaging	0.95
R4760:Hhipl1	UTSW	12	108320077	missense	probably damaging	0.99
R4927:Hhipl1	UTSW	12	108311944	missense	probably damaging	1.00
R5206:Hhipl1	UTSW	12	108312178	missense	probably damaging	1.00
R5244:Hhipl1	UTSW	12	108312134	missense	probably damaging	0.99
R5292:Hhipl1	UTSW	12	108327778	missense	probably benign
R5445:Hhipl1	UTSW	12	108328208	missense	probably damaging	0.97
R9395:Hhipl1	UTSW	12	108318750	missense	probably damaging	1.00
R9451:Hhipl1	UTSW	12	108327841	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- AACCCGTTCGTGGATGATCC -3'
(R):5'- TGCAACAGATCTCAGTCTCTG -3'

Sequencing Primer
(F):5'- TTCGTGGATGATCCCGGAGC -3'
(R):5'- ATCCATGTCGAGGGTCTACATAG -3'

Posted On

2018-02-28