Incidental Mutation 'R6247:Ano5'
ID505691
Institutional Source Beutler Lab
Gene Symbol Ano5
Ensembl Gene ENSMUSG00000055489
Gene Nameanoctamin 5
SynonymsGdd1, Tmem16e
MMRRC Submission 044366-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R6247 (G1)
Quality Score193.009
Status Not validated
Chromosome7
Chromosomal Location51511029-51598709 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to A at 51566131 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043944] [ENSMUST00000207044] [ENSMUST00000207717]
Predicted Effect probably null
Transcript: ENSMUST00000043944
SMART Domains Protein: ENSMUSP00000046884
Gene: ENSMUSG00000055489

DomainStartEndE-ValueType
low complexity region 42 55 N/A INTRINSIC
Pfam:Anoct_dimer 64 280 7.7e-70 PFAM
Pfam:Anoctamin 283 860 6.5e-138 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000207044
Predicted Effect probably null
Transcript: ENSMUST00000207717
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the anoctamin family, which in mammals is comprised of 10 members. Anoctamin proteins are proposed to have eight transmembrane domains with both termini facing the cytoplasm and a C-terminal domain of unknown function. While some members have been characterized as calcium-activated chloride channels, this protein is reported to have little anion conductance activity. Elevated levels of this protein were found in dystrophic mice. In humans, mutations of this gene are associated with with musculoskeletal disorders such as myopathies, muscular dystrophy and gnathodiaphyseal dysplasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
PHENOTYPE: One type of homozygous KO causes abnormalities in skeletal muscle mitochondria and impairs muscle regeneration and repair, leading to exercise intolerance. Another type of homozygous KO impairs sperm motility, leading to male subfertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik T C 11: 72,158,942 D871G probably benign Het
A4galt G T 15: 83,227,819 H254Q probably damaging Het
AA986860 C A 1: 130,743,043 T334K possibly damaging Het
Abca13 T C 11: 9,403,874 I3732T probably benign Het
Abcf1 C T 17: 35,961,064 D353N probably damaging Het
Adssl1 A G 12: 112,628,356 H83R probably damaging Het
Amer2 C A 14: 60,378,872 A172E probably damaging Het
Ankhd1 A G 18: 36,654,146 T2300A probably benign Het
Apob G A 12: 8,001,801 G1109D probably damaging Het
Arhgef26 A T 3: 62,380,960 N484Y probably damaging Het
C6 A G 15: 4,763,541 D376G probably damaging Het
Caml T C 13: 55,625,173 probably null Het
Capn12 T C 7: 28,888,652 L473S probably benign Het
Cdk6 G A 5: 3,344,553 probably null Het
Cers5 A T 15: 99,745,924 C153S probably benign Het
Cfap206 T C 4: 34,692,530 M499V probably benign Het
Chd6 A G 2: 160,950,048 M2463T probably damaging Het
Chn1 T C 2: 73,707,006 E58G possibly damaging Het
Clec4a1 T C 6: 122,928,042 V100A probably benign Het
Col7a1 G C 9: 108,981,062 probably benign Het
Csmd1 A G 8: 16,196,235 V1050A possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dennd5a A T 7: 109,898,682 C1044S probably damaging Het
Dnah7b A G 1: 46,225,888 T2181A probably benign Het
Dnaic1 T C 4: 41,605,775 V255A probably benign Het
Dync2h1 A G 9: 7,135,078 C1518R probably damaging Het
Dysf T C 6: 84,066,999 V273A probably damaging Het
Eif1 C T 11: 100,320,397 probably benign Het
Eml3 T C 19: 8,930,949 I58T probably benign Het
Fam171b T A 2: 83,879,208 I408N probably damaging Het
Fchsd2 A G 7: 101,253,540 E351G probably benign Het
Focad G A 4: 88,407,140 A81T possibly damaging Het
Fpr-rs4 G A 17: 18,022,486 V252I probably benign Het
Fryl A G 5: 73,065,481 L1919P probably damaging Het
Gm12185 C T 11: 48,915,908 R152H probably damaging Het
Gm14410 C T 2: 177,193,724 G249E probably damaging Het
Gm3854 T C 7: 6,353,946 C253R probably damaging Het
Gm6685 A T 11: 28,339,706 S37T possibly damaging Het
Greb1 G A 12: 16,716,675 P374L probably damaging Het
Hdac4 A T 1: 92,012,838 probably null Het
Hecw1 A T 13: 14,234,425 L1099* probably null Het
Hivep1 T C 13: 42,157,490 S1069P probably benign Het
Itgad T C 7: 128,185,787 I288T possibly damaging Het
Kif9 A G 9: 110,488,544 M96V possibly damaging Het
Kncn T A 4: 115,884,790 V18E probably damaging Het
Lrrc74a G A 12: 86,758,556 G384D probably damaging Het
Ltb4r2 T C 14: 55,762,651 V243A probably damaging Het
Mtnr1b T A 9: 15,862,786 I326L probably benign Het
Mylip C T 13: 45,408,481 T253I probably damaging Het
Necap1 T A 6: 122,880,652 probably null Het
Nedd4 C T 9: 72,726,438 P409S probably damaging Het
Npat A T 9: 53,545,238 E36D probably damaging Het
Ovch2 C T 7: 107,785,441 V490M probably damaging Het
Pax9 T C 12: 56,709,695 S273P probably benign Het
Plce1 A G 19: 38,745,845 E1563G probably damaging Het
Podxl2 C A 6: 88,849,317 G336* probably null Het
Prdm1 A G 10: 44,446,786 probably null Het
Psme4 T C 11: 30,853,245 I29T possibly damaging Het
Ptprd A T 4: 76,066,291 D780E probably benign Het
Retsat T C 6: 72,604,935 M294T probably benign Het
Robo2 A T 16: 73,967,784 V652D probably damaging Het
Rptn C G 3: 93,398,130 H923Q possibly damaging Het
Serpinb3d G T 1: 107,082,760 T66K probably benign Het
Setd1b A T 5: 123,158,398 probably benign Het
Slc7a10 G T 7: 35,186,587 A36S possibly damaging Het
Sstr3 T A 15: 78,539,588 I320F probably damaging Het
Syne1 G T 10: 5,349,071 A1005E probably damaging Het
Syngap1 C A 17: 26,962,957 S975* probably null Het
Tinagl1 C T 4: 130,172,932 C124Y probably null Het
Tm9sf1 C T 14: 55,636,370 R557H probably damaging Het
Tmed2 T A 5: 124,546,992 I68K possibly damaging Het
Tmem104 A G 11: 115,243,993 T451A probably benign Het
Tmem141 T C 2: 25,621,681 probably null Het
Tmem184a C A 5: 139,813,072 V41L probably benign Het
Tmem39b C T 4: 129,686,791 V303I possibly damaging Het
Tsn T C 1: 118,305,209 I122V probably benign Het
Ttc41 G T 10: 86,776,663 V1267L probably benign Het
Uggt1 A T 1: 36,163,228 L1096Q probably damaging Het
Usp50 A T 2: 126,775,793 I244N probably benign Het
Vil1 A G 1: 74,432,339 S760G probably benign Het
Wasf1 T A 10: 40,937,745 V541E unknown Het
Zc3h13 G T 14: 75,343,736 S1721I probably benign Het
Zfp180 G T 7: 24,105,105 K316N probably damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Zfp759 A G 13: 67,140,460 T692A probably benign Het
Zfyve26 A G 12: 79,282,984 V476A probably benign Het
Other mutations in Ano5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00653:Ano5 APN 7 51566513 missense probably damaging 0.96
IGL01328:Ano5 APN 7 51556271 critical splice donor site probably null
IGL01800:Ano5 APN 7 51573075 critical splice donor site probably null
IGL01888:Ano5 APN 7 51566300 missense probably benign 0.06
IGL02221:Ano5 APN 7 51570323 missense probably damaging 1.00
IGL02538:Ano5 APN 7 51583775 missense probably damaging 1.00
IGL03027:Ano5 APN 7 51566277 missense probably damaging 0.99
IGL03133:Ano5 APN 7 51576512 nonsense probably null
IGL03167:Ano5 APN 7 51585511 missense probably damaging 0.98
IGL03233:Ano5 APN 7 51570368 missense probably damaging 1.00
PIT4466001:Ano5 UTSW 7 51544851 missense probably damaging 1.00
R0233:Ano5 UTSW 7 51535470 missense possibly damaging 0.94
R0233:Ano5 UTSW 7 51535470 missense possibly damaging 0.94
R0675:Ano5 UTSW 7 51574810 missense probably damaging 1.00
R0723:Ano5 UTSW 7 51587758 missense probably benign 0.20
R0764:Ano5 UTSW 7 51537842 splice site probably benign
R1159:Ano5 UTSW 7 51579474 splice site probably benign
R1218:Ano5 UTSW 7 51570421 splice site probably null
R1288:Ano5 UTSW 7 51546872 missense probably damaging 1.00
R1329:Ano5 UTSW 7 51546785 missense probably benign
R1484:Ano5 UTSW 7 51566320 missense probably damaging 1.00
R1496:Ano5 UTSW 7 51583775 missense probably damaging 1.00
R1512:Ano5 UTSW 7 51579568 missense probably benign 0.00
R1691:Ano5 UTSW 7 51590579 missense probably damaging 1.00
R1859:Ano5 UTSW 7 51546833 missense probably damaging 1.00
R1991:Ano5 UTSW 7 51537813 missense possibly damaging 0.59
R2066:Ano5 UTSW 7 51585386 missense probably damaging 1.00
R2088:Ano5 UTSW 7 51587706 missense possibly damaging 0.50
R2103:Ano5 UTSW 7 51537813 missense possibly damaging 0.59
R2248:Ano5 UTSW 7 51593789 missense probably benign 0.00
R3692:Ano5 UTSW 7 51590579 missense probably damaging 1.00
R3723:Ano5 UTSW 7 51576528 missense probably damaging 1.00
R3805:Ano5 UTSW 7 51576650 missense probably benign 0.22
R3883:Ano5 UTSW 7 51566304 missense probably damaging 1.00
R3978:Ano5 UTSW 7 51587806 missense probably benign
R4035:Ano5 UTSW 7 51566485 splice site probably benign
R4239:Ano5 UTSW 7 51587666 missense probably damaging 0.99
R4466:Ano5 UTSW 7 51570275 missense probably damaging 1.00
R4644:Ano5 UTSW 7 51587685 nonsense probably null
R5021:Ano5 UTSW 7 51556185 missense probably benign
R5028:Ano5 UTSW 7 51537710 splice site probably null
R5609:Ano5 UTSW 7 51593637 missense probably damaging 1.00
R5659:Ano5 UTSW 7 51583814 missense possibly damaging 0.94
R5660:Ano5 UTSW 7 51583814 missense possibly damaging 0.94
R5680:Ano5 UTSW 7 51583814 missense possibly damaging 0.94
R5786:Ano5 UTSW 7 51566318 missense possibly damaging 0.88
R5787:Ano5 UTSW 7 51566318 missense possibly damaging 0.88
R5788:Ano5 UTSW 7 51566318 missense possibly damaging 0.88
R5856:Ano5 UTSW 7 51585326 missense probably benign 0.01
R5930:Ano5 UTSW 7 51585331 missense probably damaging 0.99
R5984:Ano5 UTSW 7 51593664 missense probably damaging 1.00
R6015:Ano5 UTSW 7 51574777 missense probably benign 0.00
R6030:Ano5 UTSW 7 51574825 missense probably damaging 1.00
R6030:Ano5 UTSW 7 51574825 missense probably damaging 1.00
R7552:Ano5 UTSW 7 51546780 missense probably benign 0.31
R7559:Ano5 UTSW 7 51574888 missense probably damaging 1.00
R7712:Ano5 UTSW 7 51573057 missense probably benign 0.00
R7712:Ano5 UTSW 7 51590655 missense probably damaging 1.00
R7805:Ano5 UTSW 7 51537800 missense probably damaging 0.97
R7808:Ano5 UTSW 7 51587795 missense possibly damaging 0.53
R7840:Ano5 UTSW 7 51587732 missense possibly damaging 0.88
R7886:Ano5 UTSW 7 51570393 missense probably benign 0.12
R8006:Ano5 UTSW 7 51593770 missense probably benign 0.05
R8060:Ano5 UTSW 7 51587783 missense probably benign 0.01
R8084:Ano5 UTSW 7 51579539 missense probably benign 0.01
X0062:Ano5 UTSW 7 51593651 nonsense probably null
X0065:Ano5 UTSW 7 51576628 nonsense probably null
Z1176:Ano5 UTSW 7 51574703 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGAGGAAAACCATCCCTATCTCTTC -3'
(R):5'- CGCAAAGTGGGCACATGATC -3'

Sequencing Primer
(F):5'- CACATGTGTGTAGGACCATGCAC -3'
(R):5'- TGGGCACATGATCATCTGAC -3'
Posted On2018-02-28