Incidental Mutation 'R6247:Ovch2'
ID 505693
Institutional Source Beutler Lab
Gene Symbol Ovch2
Ensembl Gene ENSMUSG00000048236
Gene Name ovochymase 2
Synonyms 9230106D23Rik
MMRRC Submission 044366-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6247 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 107380751-107400386 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 107384648 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 490 (V490M)
Ref Sequence ENSEMBL: ENSMUSP00000102366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106755]
AlphaFold Q7M761
Predicted Effect probably damaging
Transcript: ENSMUST00000106755
AA Change: V490M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102366
Gene: ENSMUSG00000048236
AA Change: V490M

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Tryp_SPc 51 294 6.58e-93 SMART
CUB 314 421 1.68e-17 SMART
CUB 431 543 5.02e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207742
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208448
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik T C 11: 72,049,768 (GRCm39) D871G probably benign Het
A4galt G T 15: 83,112,020 (GRCm39) H254Q probably damaging Het
AA986860 C A 1: 130,670,780 (GRCm39) T334K possibly damaging Het
Abca13 T C 11: 9,353,874 (GRCm39) I3732T probably benign Het
Abcf1 C T 17: 36,271,956 (GRCm39) D353N probably damaging Het
Adss1 A G 12: 112,594,790 (GRCm39) H83R probably damaging Het
Amer2 C A 14: 60,616,321 (GRCm39) A172E probably damaging Het
Ankhd1 A G 18: 36,787,199 (GRCm39) T2300A probably benign Het
Ano5 G A 7: 51,215,879 (GRCm39) probably null Het
Apob G A 12: 8,051,801 (GRCm39) G1109D probably damaging Het
Arhgef26 A T 3: 62,288,381 (GRCm39) N484Y probably damaging Het
C6 A G 15: 4,793,023 (GRCm39) D376G probably damaging Het
Caml T C 13: 55,772,986 (GRCm39) probably null Het
Capn12 T C 7: 28,588,077 (GRCm39) L473S probably benign Het
Cdk6 G A 5: 3,394,553 (GRCm39) probably null Het
Cers5 A T 15: 99,643,805 (GRCm39) C153S probably benign Het
Cfap206 T C 4: 34,692,530 (GRCm39) M499V probably benign Het
Chd6 A G 2: 160,791,968 (GRCm39) M2463T probably damaging Het
Chn1 T C 2: 73,537,350 (GRCm39) E58G possibly damaging Het
Clec4a1 T C 6: 122,905,001 (GRCm39) V100A probably benign Het
Col7a1 G C 9: 108,810,130 (GRCm39) probably benign Het
Csmd1 A G 8: 16,246,249 (GRCm39) V1050A possibly damaging Het
Dab1 C T 4: 104,588,948 (GRCm39) A524V probably benign Het
Dennd5a A T 7: 109,497,889 (GRCm39) C1044S probably damaging Het
Dnah7b A G 1: 46,265,048 (GRCm39) T2181A probably benign Het
Dnai1 T C 4: 41,605,775 (GRCm39) V255A probably benign Het
Dync2h1 A G 9: 7,135,078 (GRCm39) C1518R probably damaging Het
Dysf T C 6: 84,043,981 (GRCm39) V273A probably damaging Het
Eif1 C T 11: 100,211,223 (GRCm39) probably benign Het
Eml3 T C 19: 8,908,313 (GRCm39) I58T probably benign Het
Fam171b T A 2: 83,709,552 (GRCm39) I408N probably damaging Het
Fchsd2 A G 7: 100,902,747 (GRCm39) E351G probably benign Het
Focad G A 4: 88,325,377 (GRCm39) A81T possibly damaging Het
Fpr-rs4 G A 17: 18,242,748 (GRCm39) V252I probably benign Het
Fryl A G 5: 73,222,824 (GRCm39) L1919P probably damaging Het
Gm12185 C T 11: 48,806,735 (GRCm39) R152H probably damaging Het
Gm14410 C T 2: 176,885,517 (GRCm39) G249E probably damaging Het
Gm6685 A T 11: 28,289,706 (GRCm39) S37T possibly damaging Het
Greb1 G A 12: 16,766,676 (GRCm39) P374L probably damaging Het
Hdac4 A T 1: 91,940,560 (GRCm39) probably null Het
Hecw1 A T 13: 14,409,010 (GRCm39) L1099* probably null Het
Hivep1 T C 13: 42,310,966 (GRCm39) S1069P probably benign Het
Itgad T C 7: 127,784,959 (GRCm39) I288T possibly damaging Het
Kif9 A G 9: 110,317,612 (GRCm39) M96V possibly damaging Het
Kncn T A 4: 115,741,987 (GRCm39) V18E probably damaging Het
Lrrc74a G A 12: 86,805,330 (GRCm39) G384D probably damaging Het
Ltb4r2 T C 14: 56,000,108 (GRCm39) V243A probably damaging Het
Mtnr1b T A 9: 15,774,082 (GRCm39) I326L probably benign Het
Mylip C T 13: 45,561,957 (GRCm39) T253I probably damaging Het
Necap1 T A 6: 122,857,611 (GRCm39) probably null Het
Nedd4 C T 9: 72,633,720 (GRCm39) P409S probably damaging Het
Npat A T 9: 53,456,538 (GRCm39) E36D probably damaging Het
Pax9 T C 12: 56,756,480 (GRCm39) S273P probably benign Het
Plce1 A G 19: 38,734,289 (GRCm39) E1563G probably damaging Het
Podxl2 C A 6: 88,826,299 (GRCm39) G336* probably null Het
Prdm1 A G 10: 44,322,782 (GRCm39) probably null Het
Psme4 T C 11: 30,803,245 (GRCm39) I29T possibly damaging Het
Ptprd A T 4: 75,984,528 (GRCm39) D780E probably benign Het
Retsat T C 6: 72,581,918 (GRCm39) M294T probably benign Het
Robo2 A T 16: 73,764,672 (GRCm39) V652D probably damaging Het
Rptn C G 3: 93,305,437 (GRCm39) H923Q possibly damaging Het
Serpinb3d G T 1: 107,010,490 (GRCm39) T66K probably benign Het
Setd1b A T 5: 123,296,461 (GRCm39) probably benign Het
Slc7a10 G T 7: 34,886,012 (GRCm39) A36S possibly damaging Het
Sstr3 T A 15: 78,423,788 (GRCm39) I320F probably damaging Het
Syne1 G T 10: 5,299,071 (GRCm39) A1005E probably damaging Het
Syngap1 C A 17: 27,181,931 (GRCm39) S975* probably null Het
Tinagl1 C T 4: 130,066,725 (GRCm39) C124Y probably null Het
Tm9sf1 C T 14: 55,873,827 (GRCm39) R557H probably damaging Het
Tmed2 T A 5: 124,685,055 (GRCm39) I68K possibly damaging Het
Tmem104 A G 11: 115,134,819 (GRCm39) T451A probably benign Het
Tmem141 T C 2: 25,511,693 (GRCm39) probably null Het
Tmem184a C A 5: 139,798,827 (GRCm39) V41L probably benign Het
Tmem39b C T 4: 129,580,584 (GRCm39) V303I possibly damaging Het
Tsn T C 1: 118,232,939 (GRCm39) I122V probably benign Het
Ttc41 G T 10: 86,612,527 (GRCm39) V1267L probably benign Het
Uggt1 A T 1: 36,202,309 (GRCm39) L1096Q probably damaging Het
Usp50 A T 2: 126,617,713 (GRCm39) I244N probably benign Het
Vil1 A G 1: 74,471,498 (GRCm39) S760G probably benign Het
Wasf1 T A 10: 40,813,741 (GRCm39) V541E unknown Het
Zc3h13 G T 14: 75,581,176 (GRCm39) S1721I probably benign Het
Zfp180 G T 7: 23,804,530 (GRCm39) K316N probably damaging Het
Zfp582 T C 7: 6,356,945 (GRCm39) C253R probably damaging Het
Zfp709 TCGACG TCG 8: 72,644,552 (GRCm39) probably benign Het
Zfp759 A G 13: 67,288,524 (GRCm39) T692A probably benign Het
Zfyve26 A G 12: 79,329,758 (GRCm39) V476A probably benign Het
Other mutations in Ovch2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00568:Ovch2 APN 7 107,388,297 (GRCm39) missense probably null 1.00
IGL02198:Ovch2 APN 7 107,394,041 (GRCm39) missense probably damaging 0.99
IGL02200:Ovch2 APN 7 107,394,030 (GRCm39) missense probably damaging 1.00
IGL02442:Ovch2 APN 7 107,395,755 (GRCm39) missense possibly damaging 0.90
IGL02531:Ovch2 APN 7 107,389,405 (GRCm39) missense probably damaging 1.00
IGL02862:Ovch2 APN 7 107,394,138 (GRCm39) missense probably damaging 1.00
R0401:Ovch2 UTSW 7 107,400,343 (GRCm39) missense probably damaging 0.98
R0413:Ovch2 UTSW 7 107,381,243 (GRCm39) missense probably benign
R0631:Ovch2 UTSW 7 107,381,228 (GRCm39) missense probably benign 0.01
R1028:Ovch2 UTSW 7 107,395,755 (GRCm39) missense probably benign 0.37
R1329:Ovch2 UTSW 7 107,384,653 (GRCm39) missense probably damaging 1.00
R1809:Ovch2 UTSW 7 107,389,412 (GRCm39) critical splice acceptor site probably null
R2254:Ovch2 UTSW 7 107,389,402 (GRCm39) missense probably benign 0.02
R2265:Ovch2 UTSW 7 107,383,782 (GRCm39) missense probably damaging 1.00
R2358:Ovch2 UTSW 7 107,394,122 (GRCm39) missense probably damaging 1.00
R2922:Ovch2 UTSW 7 107,389,596 (GRCm39) missense possibly damaging 0.88
R2923:Ovch2 UTSW 7 107,389,596 (GRCm39) missense possibly damaging 0.88
R3034:Ovch2 UTSW 7 107,384,699 (GRCm39) missense probably damaging 1.00
R3885:Ovch2 UTSW 7 107,395,775 (GRCm39) missense probably damaging 1.00
R3957:Ovch2 UTSW 7 107,388,318 (GRCm39) missense probably damaging 0.99
R4687:Ovch2 UTSW 7 107,395,755 (GRCm39) missense possibly damaging 0.90
R5307:Ovch2 UTSW 7 107,391,341 (GRCm39) missense probably benign 0.26
R5353:Ovch2 UTSW 7 107,393,631 (GRCm39) missense probably damaging 0.98
R5688:Ovch2 UTSW 7 107,393,201 (GRCm39) missense probably damaging 1.00
R5730:Ovch2 UTSW 7 107,392,606 (GRCm39) missense probably damaging 1.00
R5767:Ovch2 UTSW 7 107,381,185 (GRCm39) missense probably benign
R5979:Ovch2 UTSW 7 107,393,595 (GRCm39) missense possibly damaging 0.94
R6039:Ovch2 UTSW 7 107,388,318 (GRCm39) missense probably damaging 0.99
R6039:Ovch2 UTSW 7 107,388,318 (GRCm39) missense probably damaging 0.99
R6064:Ovch2 UTSW 7 107,395,779 (GRCm39) missense probably damaging 0.98
R6638:Ovch2 UTSW 7 107,388,301 (GRCm39) missense probably benign 0.17
R6877:Ovch2 UTSW 7 107,389,315 (GRCm39) missense probably benign 0.25
R7040:Ovch2 UTSW 7 107,395,772 (GRCm39) missense probably damaging 1.00
R7257:Ovch2 UTSW 7 107,393,640 (GRCm39) missense probably damaging 1.00
R7282:Ovch2 UTSW 7 107,393,577 (GRCm39) missense possibly damaging 0.94
R7824:Ovch2 UTSW 7 107,388,295 (GRCm39) critical splice donor site probably null
R7841:Ovch2 UTSW 7 107,393,298 (GRCm39) missense probably benign 0.01
R7908:Ovch2 UTSW 7 107,388,326 (GRCm39) missense probably damaging 1.00
R8427:Ovch2 UTSW 7 107,393,207 (GRCm39) missense probably damaging 1.00
R8745:Ovch2 UTSW 7 107,389,584 (GRCm39) missense possibly damaging 0.93
R8812:Ovch2 UTSW 7 107,393,251 (GRCm39) nonsense probably null
R8812:Ovch2 UTSW 7 107,392,462 (GRCm39) missense probably damaging 1.00
R9250:Ovch2 UTSW 7 107,392,542 (GRCm39) missense probably damaging 1.00
R9301:Ovch2 UTSW 7 107,395,815 (GRCm39) missense probably damaging 1.00
R9308:Ovch2 UTSW 7 107,389,560 (GRCm39) missense probably benign 0.03
R9703:Ovch2 UTSW 7 107,383,777 (GRCm39) missense probably damaging 1.00
R9717:Ovch2 UTSW 7 107,393,584 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACCCTACATGAAAGCAGAAGG -3'
(R):5'- CTGCACGCAAGCTGTATTTG -3'

Sequencing Primer
(F):5'- CCTACATGAAAGCAGAAGGAGTGG -3'
(R):5'- GCACGCAAGCTGTATTTGATAGC -3'
Posted On 2018-02-28