Incidental Mutation 'R6247:Itgad'
ID505695
Institutional Source Beutler Lab
Gene Symbol Itgad
Ensembl Gene ENSMUSG00000070369
Gene Nameintegrin, alpha D
SynonymsCd11d
MMRRC Submission 044366-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R6247 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location128154376-128223816 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 128185787 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 288 (I288T)
Ref Sequence ENSEMBL: ENSMUSP00000135572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033051] [ENSMUST00000106237] [ENSMUST00000177111]
Predicted Effect probably benign
Transcript: ENSMUST00000033051
AA Change: I324T

PolyPhen 2 Score 0.411 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000033051
Gene: ENSMUSG00000070369
AA Change: I324T

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Int_alpha 38 88 1.35e1 SMART
VWA 155 376 1.24e-36 SMART
Blast:VWA 405 436 1e-9 BLAST
Int_alpha 443 492 3.67e-3 SMART
Int_alpha 496 553 1.03e-6 SMART
Int_alpha 559 615 1.73e-13 SMART
Int_alpha 622 676 1.69e-2 SMART
transmembrane domain 1142 1164 N/A INTRINSIC
Pfam:Integrin_alpha 1165 1179 1.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106237
AA Change: I290T

PolyPhen 2 Score 0.371 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000101844
Gene: ENSMUSG00000070369
AA Change: I290T

DomainStartEndE-ValueType
Int_alpha 40 90 1.35e1 SMART
VWA 157 342 1.31e-44 SMART
Blast:VWA 371 402 9e-10 BLAST
Int_alpha 409 458 3.67e-3 SMART
Int_alpha 462 519 1.03e-6 SMART
Int_alpha 525 581 1.73e-13 SMART
Int_alpha 588 642 1.69e-2 SMART
transmembrane domain 1108 1130 N/A INTRINSIC
Pfam:Integrin_alpha 1131 1145 4.3e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000177111
AA Change: I288T

PolyPhen 2 Score 0.479 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000135572
Gene: ENSMUSG00000070369
AA Change: I288T

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Int_alpha 38 88 1.35e1 SMART
VWA 155 340 1.31e-44 SMART
Blast:VWA 369 400 9e-10 BLAST
Int_alpha 407 456 3.67e-3 SMART
Int_alpha 460 517 1.03e-6 SMART
Int_alpha 523 579 1.73e-13 SMART
Int_alpha 586 640 1.69e-2 SMART
transmembrane domain 1106 1128 N/A INTRINSIC
Pfam:Integrin_alpha 1129 1143 5.4e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206189
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the beta-2 integrin family of membrane glycoproteins, which are are composed of non-covalently linked alpha and beta subunits to form a heterodimer. It encodes the alpha subunit of the cell surface heterodimers and is involved in the activation and adhesion functions of leukocytes. The gene is located about 11kb downstream of the integrin subunit alpha X gene, another member of the integrin family. It is expressed in the tissue and circulating myeloid leukocytes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous null mice exhibit a reduced staphylococcal enterotoxin-induced T cell response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik T C 11: 72,158,942 D871G probably benign Het
A4galt G T 15: 83,227,819 H254Q probably damaging Het
AA986860 C A 1: 130,743,043 T334K possibly damaging Het
Abca13 T C 11: 9,403,874 I3732T probably benign Het
Abcf1 C T 17: 35,961,064 D353N probably damaging Het
Adssl1 A G 12: 112,628,356 H83R probably damaging Het
Amer2 C A 14: 60,378,872 A172E probably damaging Het
Ankhd1 A G 18: 36,654,146 T2300A probably benign Het
Ano5 G A 7: 51,566,131 probably null Het
Apob G A 12: 8,001,801 G1109D probably damaging Het
Arhgef26 A T 3: 62,380,960 N484Y probably damaging Het
C6 A G 15: 4,763,541 D376G probably damaging Het
Caml T C 13: 55,625,173 probably null Het
Capn12 T C 7: 28,888,652 L473S probably benign Het
Cdk6 G A 5: 3,344,553 probably null Het
Cers5 A T 15: 99,745,924 C153S probably benign Het
Cfap206 T C 4: 34,692,530 M499V probably benign Het
Chd6 A G 2: 160,950,048 M2463T probably damaging Het
Chn1 T C 2: 73,707,006 E58G possibly damaging Het
Clec4a1 T C 6: 122,928,042 V100A probably benign Het
Col7a1 G C 9: 108,981,062 probably benign Het
Csmd1 A G 8: 16,196,235 V1050A possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dennd5a A T 7: 109,898,682 C1044S probably damaging Het
Dnah7b A G 1: 46,225,888 T2181A probably benign Het
Dnaic1 T C 4: 41,605,775 V255A probably benign Het
Dync2h1 A G 9: 7,135,078 C1518R probably damaging Het
Dysf T C 6: 84,066,999 V273A probably damaging Het
Eif1 C T 11: 100,320,397 probably benign Het
Eml3 T C 19: 8,930,949 I58T probably benign Het
Fam171b T A 2: 83,879,208 I408N probably damaging Het
Fchsd2 A G 7: 101,253,540 E351G probably benign Het
Focad G A 4: 88,407,140 A81T possibly damaging Het
Fpr-rs4 G A 17: 18,022,486 V252I probably benign Het
Fryl A G 5: 73,065,481 L1919P probably damaging Het
Gm12185 C T 11: 48,915,908 R152H probably damaging Het
Gm14410 C T 2: 177,193,724 G249E probably damaging Het
Gm3854 T C 7: 6,353,946 C253R probably damaging Het
Gm6685 A T 11: 28,339,706 S37T possibly damaging Het
Greb1 G A 12: 16,716,675 P374L probably damaging Het
Hdac4 A T 1: 92,012,838 probably null Het
Hecw1 A T 13: 14,234,425 L1099* probably null Het
Hivep1 T C 13: 42,157,490 S1069P probably benign Het
Kif9 A G 9: 110,488,544 M96V possibly damaging Het
Kncn T A 4: 115,884,790 V18E probably damaging Het
Lrrc74a G A 12: 86,758,556 G384D probably damaging Het
Ltb4r2 T C 14: 55,762,651 V243A probably damaging Het
Mtnr1b T A 9: 15,862,786 I326L probably benign Het
Mylip C T 13: 45,408,481 T253I probably damaging Het
Necap1 T A 6: 122,880,652 probably null Het
Nedd4 C T 9: 72,726,438 P409S probably damaging Het
Npat A T 9: 53,545,238 E36D probably damaging Het
Ovch2 C T 7: 107,785,441 V490M probably damaging Het
Pax9 T C 12: 56,709,695 S273P probably benign Het
Plce1 A G 19: 38,745,845 E1563G probably damaging Het
Podxl2 C A 6: 88,849,317 G336* probably null Het
Prdm1 A G 10: 44,446,786 probably null Het
Psme4 T C 11: 30,853,245 I29T possibly damaging Het
Ptprd A T 4: 76,066,291 D780E probably benign Het
Retsat T C 6: 72,604,935 M294T probably benign Het
Robo2 A T 16: 73,967,784 V652D probably damaging Het
Rptn C G 3: 93,398,130 H923Q possibly damaging Het
Serpinb3d G T 1: 107,082,760 T66K probably benign Het
Setd1b A T 5: 123,158,398 probably benign Het
Slc7a10 G T 7: 35,186,587 A36S possibly damaging Het
Sstr3 T A 15: 78,539,588 I320F probably damaging Het
Syne1 G T 10: 5,349,071 A1005E probably damaging Het
Syngap1 C A 17: 26,962,957 S975* probably null Het
Tinagl1 C T 4: 130,172,932 C124Y probably null Het
Tm9sf1 C T 14: 55,636,370 R557H probably damaging Het
Tmed2 T A 5: 124,546,992 I68K possibly damaging Het
Tmem104 A G 11: 115,243,993 T451A probably benign Het
Tmem141 T C 2: 25,621,681 probably null Het
Tmem184a C A 5: 139,813,072 V41L probably benign Het
Tmem39b C T 4: 129,686,791 V303I possibly damaging Het
Tsn T C 1: 118,305,209 I122V probably benign Het
Ttc41 G T 10: 86,776,663 V1267L probably benign Het
Uggt1 A T 1: 36,163,228 L1096Q probably damaging Het
Usp50 A T 2: 126,775,793 I244N probably benign Het
Vil1 A G 1: 74,432,339 S760G probably benign Het
Wasf1 T A 10: 40,937,745 V541E unknown Het
Zc3h13 G T 14: 75,343,736 S1721I probably benign Het
Zfp180 G T 7: 24,105,105 K316N probably damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Zfp759 A G 13: 67,140,460 T692A probably benign Het
Zfyve26 A G 12: 79,282,984 V476A probably benign Het
Other mutations in Itgad
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Itgad APN 7 128203850 missense probably damaging 0.99
IGL02036:Itgad APN 7 128189821 missense possibly damaging 0.49
IGL02589:Itgad APN 7 128181711 missense probably damaging 1.00
IGL02648:Itgad APN 7 128183374 intron probably benign
IGL02735:Itgad APN 7 128193716 missense probably damaging 1.00
IGL03088:Itgad APN 7 128203032 missense probably benign 0.01
IGL03110:Itgad APN 7 128185985 missense probably damaging 1.00
BB007:Itgad UTSW 7 128183108 missense probably benign 0.01
BB017:Itgad UTSW 7 128183108 missense probably benign 0.01
R0060:Itgad UTSW 7 128202986 missense probably damaging 1.00
R0060:Itgad UTSW 7 128202986 missense probably damaging 1.00
R0184:Itgad UTSW 7 128189231 missense probably benign 0.02
R0211:Itgad UTSW 7 128204641 missense probably damaging 1.00
R0211:Itgad UTSW 7 128204641 missense probably damaging 1.00
R0282:Itgad UTSW 7 128189978 splice site probably benign
R0326:Itgad UTSW 7 128198378 missense probably benign 0.00
R0646:Itgad UTSW 7 128174004 missense possibly damaging 0.89
R0947:Itgad UTSW 7 128175693 missense probably benign 0.08
R1439:Itgad UTSW 7 128183006 missense probably benign 0.44
R1454:Itgad UTSW 7 128192137 missense probably benign 0.02
R1503:Itgad UTSW 7 128198121 missense probably benign 0.00
R1531:Itgad UTSW 7 128178370 missense probably benign 0.00
R1572:Itgad UTSW 7 128203234 missense probably damaging 1.00
R1602:Itgad UTSW 7 128190939 missense probably damaging 1.00
R1732:Itgad UTSW 7 128205107 missense probably benign
R2278:Itgad UTSW 7 128205170 missense possibly damaging 0.93
R2851:Itgad UTSW 7 128204560 missense probably benign 0.01
R3029:Itgad UTSW 7 128178371 missense possibly damaging 0.85
R3080:Itgad UTSW 7 128185787 missense possibly damaging 0.48
R3150:Itgad UTSW 7 128190981 missense possibly damaging 0.64
R3176:Itgad UTSW 7 128190981 missense possibly damaging 0.64
R3177:Itgad UTSW 7 128190981 missense possibly damaging 0.64
R3276:Itgad UTSW 7 128190981 missense possibly damaging 0.64
R3277:Itgad UTSW 7 128190981 missense possibly damaging 0.64
R3833:Itgad UTSW 7 128186233 missense probably damaging 1.00
R4541:Itgad UTSW 7 128198115 missense probably benign 0.13
R4649:Itgad UTSW 7 128189531 missense probably benign 0.01
R4753:Itgad UTSW 7 128223703 makesense probably null
R4852:Itgad UTSW 7 128198530 missense probably damaging 1.00
R4931:Itgad UTSW 7 128204625 missense probably damaging 1.00
R4970:Itgad UTSW 7 128189843 missense possibly damaging 0.70
R5116:Itgad UTSW 7 128203893 missense probably damaging 1.00
R5183:Itgad UTSW 7 128198223 critical splice donor site probably null
R5233:Itgad UTSW 7 128193428 splice site probably null
R5334:Itgad UTSW 7 128189286 missense probably damaging 0.99
R5731:Itgad UTSW 7 128198554 missense probably benign 0.19
R5760:Itgad UTSW 7 128203365 missense probably benign 0.02
R5896:Itgad UTSW 7 128174016 missense probably benign 0.34
R5955:Itgad UTSW 7 128189481 missense probably benign 0.00
R6659:Itgad UTSW 7 128185948 missense probably damaging 1.00
R7027:Itgad UTSW 7 128182989 missense probably damaging 1.00
R7104:Itgad UTSW 7 128198378 missense probably benign 0.00
R7120:Itgad UTSW 7 128173974 start codon destroyed probably null 0.02
R7272:Itgad UTSW 7 128205073 missense probably damaging 1.00
R7303:Itgad UTSW 7 128190179 missense probably benign
R7324:Itgad UTSW 7 128189807 missense probably damaging 1.00
R7565:Itgad UTSW 7 128183015 missense probably damaging 0.98
R7566:Itgad UTSW 7 128192107 missense probably benign 0.40
R7930:Itgad UTSW 7 128183108 missense probably benign 0.01
RF019:Itgad UTSW 7 128192208 missense probably benign 0.08
Z1176:Itgad UTSW 7 128190087 missense probably damaging 1.00
Z1177:Itgad UTSW 7 128189501 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGGCTTCCAAACATATTCAGAAG -3'
(R):5'- TGAGCCAATGGTGTTCAGCTC -3'

Sequencing Primer
(F):5'- AAGCCTTTGCAAATTGTCTTTCCAG -3'
(R):5'- CCAATGGTGTTCAGCTCCTGTAG -3'
Posted On2018-02-28