Incidental Mutation 'R6247:Col7a1'
ID505702
Institutional Source Beutler Lab
Gene Symbol Col7a1
Ensembl Gene ENSMUSG00000025650
Gene Namecollagen, type VII, alpha 1
Synonyms
MMRRC Submission 044366-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6247 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location108953586-108984875 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to C at 108981062 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000060405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026740] [ENSMUST00000052724] [ENSMUST00000112070]
Predicted Effect unknown
Transcript: ENSMUST00000026740
AA Change: G2674R
SMART Domains Protein: ENSMUSP00000026740
Gene: ENSMUSG00000025650
AA Change: G2674R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
VWA 37 217 1.56e-51 SMART
FN3 233 319 1.41e-10 SMART
FN3 325 405 6.54e-6 SMART
FN3 416 494 6.91e-5 SMART
FN3 509 585 1.24e-6 SMART
FN3 599 675 2.01e-6 SMART
FN3 687 763 7.45e-10 SMART
FN3 774 854 6.01e-5 SMART
FN3 865 944 7.23e-8 SMART
FN3 955 1038 2.16e-6 SMART
Pfam:VWA 1055 1227 2.3e-22 PFAM
Pfam:Collagen 1244 1311 2.4e-8 PFAM
Pfam:Collagen 1294 1355 4.1e-10 PFAM
low complexity region 1397 1414 N/A INTRINSIC
Pfam:Collagen 1447 1504 1.3e-9 PFAM
Pfam:Collagen 1487 1547 5e-8 PFAM
low complexity region 1572 1595 N/A INTRINSIC
low complexity region 1604 1632 N/A INTRINSIC
Pfam:Collagen 1646 1714 2.8e-10 PFAM
Pfam:Collagen 1713 1775 1.9e-10 PFAM
low complexity region 1776 1794 N/A INTRINSIC
low complexity region 1803 1833 N/A INTRINSIC
Pfam:Collagen 1875 1935 1.5e-8 PFAM
Pfam:Collagen 1969 2033 2.4e-9 PFAM
Pfam:Collagen 2025 2092 9.1e-10 PFAM
Pfam:Collagen 2089 2158 1.3e-10 PFAM
Pfam:Collagen 2147 2209 1.6e-9 PFAM
Pfam:Collagen 2245 2312 1.4e-8 PFAM
Pfam:Collagen 2313 2365 2.5e-8 PFAM
Pfam:Collagen 2364 2423 7.3e-10 PFAM
Pfam:Collagen 2398 2457 1.5e-9 PFAM
Pfam:Collagen 2456 2515 8.4e-11 PFAM
Pfam:Collagen 2516 2572 1.9e-9 PFAM
Pfam:Collagen 2560 2630 7.2e-9 PFAM
Pfam:Collagen 2605 2682 6e-9 PFAM
Pfam:Collagen 2659 2722 2e-8 PFAM
low complexity region 2745 2775 N/A INTRINSIC
Pfam:Kunitz_BPTI 2878 2932 3.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000052724
SMART Domains Protein: ENSMUSP00000060405
Gene: ENSMUSG00000049699

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 36 61 N/A INTRINSIC
Pfam:CRF 73 110 4.2e-18 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000112070
AA Change: G2674R
SMART Domains Protein: ENSMUSP00000107701
Gene: ENSMUSG00000025650
AA Change: G2674R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
VWA 37 217 1.56e-51 SMART
FN3 233 319 1.41e-10 SMART
FN3 325 405 6.54e-6 SMART
FN3 416 494 6.91e-5 SMART
FN3 509 585 1.24e-6 SMART
FN3 599 675 2.01e-6 SMART
FN3 687 763 7.45e-10 SMART
FN3 774 854 6.01e-5 SMART
FN3 865 944 7.23e-8 SMART
FN3 955 1038 2.16e-6 SMART
Pfam:VWA 1055 1230 2.2e-19 PFAM
Pfam:Collagen 1244 1311 2.5e-8 PFAM
Pfam:Collagen 1294 1355 4.2e-10 PFAM
low complexity region 1397 1414 N/A INTRINSIC
Pfam:Collagen 1447 1504 1.3e-9 PFAM
Pfam:Collagen 1487 1547 5.1e-8 PFAM
low complexity region 1572 1595 N/A INTRINSIC
low complexity region 1604 1632 N/A INTRINSIC
Pfam:Collagen 1646 1714 2.9e-10 PFAM
Pfam:Collagen 1713 1775 1.9e-10 PFAM
low complexity region 1776 1794 N/A INTRINSIC
low complexity region 1803 1833 N/A INTRINSIC
Pfam:Collagen 1875 1935 1.5e-8 PFAM
Pfam:Collagen 1969 2033 2.5e-9 PFAM
Pfam:Collagen 2025 2092 9.4e-10 PFAM
Pfam:Collagen 2089 2158 1.3e-10 PFAM
Pfam:Collagen 2147 2209 1.6e-9 PFAM
Pfam:Collagen 2195 2266 7.7e-7 PFAM
Pfam:Collagen 2245 2312 1.4e-8 PFAM
Pfam:Collagen 2313 2365 2.6e-8 PFAM
Pfam:Collagen 2364 2423 7.6e-10 PFAM
Pfam:Collagen 2398 2457 1.5e-9 PFAM
Pfam:Collagen 2456 2515 8.7e-11 PFAM
Pfam:Collagen 2516 2572 2e-9 PFAM
Pfam:Collagen 2560 2630 7.4e-9 PFAM
Pfam:Collagen 2605 2682 6.2e-9 PFAM
Pfam:Collagen 2659 2722 2.1e-8 PFAM
Pfam:Collagen 2719 2778 1.6e-7 PFAM
Pfam:Kunitz_BPTI 2878 2932 1.1e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126780
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138588
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149142
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198997
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type VII collagen. The type VII collagen fibril, composed of three identical alpha collagen chains, is restricted to the basement zone beneath stratified squamous epithelia. It functions as an anchoring fibril between the external epithelia and the underlying stroma. Mutations in this gene are associated with all forms of dystrophic epidermolysis bullosa. In the absence of mutations, however, an acquired form of this disease can result from an autoimmune response made to type VII collagen. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are unable to reproduce and display postnatal growth retardation, blisters and erosion at sites of trauma, nonpigmented hair growth associated with hair loss, subepidermal blistering associated with poorly formed hemidesmosomes, and high postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik T C 11: 72,158,942 D871G probably benign Het
A4galt G T 15: 83,227,819 H254Q probably damaging Het
AA986860 C A 1: 130,743,043 T334K possibly damaging Het
Abca13 T C 11: 9,403,874 I3732T probably benign Het
Abcf1 C T 17: 35,961,064 D353N probably damaging Het
Adssl1 A G 12: 112,628,356 H83R probably damaging Het
Amer2 C A 14: 60,378,872 A172E probably damaging Het
Ankhd1 A G 18: 36,654,146 T2300A probably benign Het
Ano5 G A 7: 51,566,131 probably null Het
Apob G A 12: 8,001,801 G1109D probably damaging Het
Arhgef26 A T 3: 62,380,960 N484Y probably damaging Het
C6 A G 15: 4,763,541 D376G probably damaging Het
Caml T C 13: 55,625,173 probably null Het
Capn12 T C 7: 28,888,652 L473S probably benign Het
Cdk6 G A 5: 3,344,553 probably null Het
Cers5 A T 15: 99,745,924 C153S probably benign Het
Cfap206 T C 4: 34,692,530 M499V probably benign Het
Chd6 A G 2: 160,950,048 M2463T probably damaging Het
Chn1 T C 2: 73,707,006 E58G possibly damaging Het
Clec4a1 T C 6: 122,928,042 V100A probably benign Het
Csmd1 A G 8: 16,196,235 V1050A possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dennd5a A T 7: 109,898,682 C1044S probably damaging Het
Dnah7b A G 1: 46,225,888 T2181A probably benign Het
Dnaic1 T C 4: 41,605,775 V255A probably benign Het
Dync2h1 A G 9: 7,135,078 C1518R probably damaging Het
Dysf T C 6: 84,066,999 V273A probably damaging Het
Eif1 C T 11: 100,320,397 probably benign Het
Eml3 T C 19: 8,930,949 I58T probably benign Het
Fam171b T A 2: 83,879,208 I408N probably damaging Het
Fchsd2 A G 7: 101,253,540 E351G probably benign Het
Focad G A 4: 88,407,140 A81T possibly damaging Het
Fpr-rs4 G A 17: 18,022,486 V252I probably benign Het
Fryl A G 5: 73,065,481 L1919P probably damaging Het
Gm12185 C T 11: 48,915,908 R152H probably damaging Het
Gm14410 C T 2: 177,193,724 G249E probably damaging Het
Gm3854 T C 7: 6,353,946 C253R probably damaging Het
Gm6685 A T 11: 28,339,706 S37T possibly damaging Het
Greb1 G A 12: 16,716,675 P374L probably damaging Het
Hdac4 A T 1: 92,012,838 probably null Het
Hecw1 A T 13: 14,234,425 L1099* probably null Het
Hivep1 T C 13: 42,157,490 S1069P probably benign Het
Itgad T C 7: 128,185,787 I288T possibly damaging Het
Kif9 A G 9: 110,488,544 M96V possibly damaging Het
Kncn T A 4: 115,884,790 V18E probably damaging Het
Lrrc74a G A 12: 86,758,556 G384D probably damaging Het
Ltb4r2 T C 14: 55,762,651 V243A probably damaging Het
Mtnr1b T A 9: 15,862,786 I326L probably benign Het
Mylip C T 13: 45,408,481 T253I probably damaging Het
Necap1 T A 6: 122,880,652 probably null Het
Nedd4 C T 9: 72,726,438 P409S probably damaging Het
Npat A T 9: 53,545,238 E36D probably damaging Het
Ovch2 C T 7: 107,785,441 V490M probably damaging Het
Pax9 T C 12: 56,709,695 S273P probably benign Het
Plce1 A G 19: 38,745,845 E1563G probably damaging Het
Podxl2 C A 6: 88,849,317 G336* probably null Het
Prdm1 A G 10: 44,446,786 probably null Het
Psme4 T C 11: 30,853,245 I29T possibly damaging Het
Ptprd A T 4: 76,066,291 D780E probably benign Het
Retsat T C 6: 72,604,935 M294T probably benign Het
Robo2 A T 16: 73,967,784 V652D probably damaging Het
Rptn C G 3: 93,398,130 H923Q possibly damaging Het
Serpinb3d G T 1: 107,082,760 T66K probably benign Het
Setd1b A T 5: 123,158,398 probably benign Het
Slc7a10 G T 7: 35,186,587 A36S possibly damaging Het
Sstr3 T A 15: 78,539,588 I320F probably damaging Het
Syne1 G T 10: 5,349,071 A1005E probably damaging Het
Syngap1 C A 17: 26,962,957 S975* probably null Het
Tinagl1 C T 4: 130,172,932 C124Y probably null Het
Tm9sf1 C T 14: 55,636,370 R557H probably damaging Het
Tmed2 T A 5: 124,546,992 I68K possibly damaging Het
Tmem104 A G 11: 115,243,993 T451A probably benign Het
Tmem141 T C 2: 25,621,681 probably null Het
Tmem184a C A 5: 139,813,072 V41L probably benign Het
Tmem39b C T 4: 129,686,791 V303I possibly damaging Het
Tsn T C 1: 118,305,209 I122V probably benign Het
Ttc41 G T 10: 86,776,663 V1267L probably benign Het
Uggt1 A T 1: 36,163,228 L1096Q probably damaging Het
Usp50 A T 2: 126,775,793 I244N probably benign Het
Vil1 A G 1: 74,432,339 S760G probably benign Het
Wasf1 T A 10: 40,937,745 V541E unknown Het
Zc3h13 G T 14: 75,343,736 S1721I probably benign Het
Zfp180 G T 7: 24,105,105 K316N probably damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Zfp759 A G 13: 67,140,460 T692A probably benign Het
Zfyve26 A G 12: 79,282,984 V476A probably benign Het
Other mutations in Col7a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Col7a1 APN 9 108977697 nonsense probably null
IGL01366:Col7a1 APN 9 108977119 splice site probably benign
IGL01395:Col7a1 APN 9 108983912 unclassified probably benign
IGL01410:Col7a1 APN 9 108964618 missense unknown
IGL01902:Col7a1 APN 9 108977827 missense unknown
IGL01915:Col7a1 APN 9 108955745 missense unknown
IGL01936:Col7a1 APN 9 108967999 splice site probably benign
IGL01943:Col7a1 APN 9 108984016 critical splice acceptor site probably null
IGL02026:Col7a1 APN 9 108968029 missense probably damaging 1.00
IGL02168:Col7a1 APN 9 108984075 unclassified probably benign
IGL02504:Col7a1 APN 9 108980675 missense unknown
IGL02510:Col7a1 APN 9 108973231 splice site probably benign
IGL02559:Col7a1 APN 9 108973216 missense unknown
IGL02583:Col7a1 APN 9 108962229 missense unknown
IGL02728:Col7a1 APN 9 108984104 missense probably benign 0.39
IGL03003:Col7a1 APN 9 108974956 critical splice donor site probably null
IGL03096:Col7a1 APN 9 108955788 missense unknown
IGL03122:Col7a1 APN 9 108961683 missense unknown
IGL03212:Col7a1 APN 9 108974452 missense unknown
IGL03240:Col7a1 APN 9 108968373 missense probably null 1.00
IGL03355:Col7a1 APN 9 108978160 missense unknown
smallified UTSW 9 108972813 critical splice donor site probably null
underwood UTSW 9 108968875 critical splice acceptor site probably null
PIT4131001:Col7a1 UTSW 9 108965921 splice site probably benign
R0007:Col7a1 UTSW 9 108961403 missense unknown
R0007:Col7a1 UTSW 9 108961403 missense unknown
R0078:Col7a1 UTSW 9 108974913 splice site probably benign
R0091:Col7a1 UTSW 9 108967506 splice site probably benign
R0126:Col7a1 UTSW 9 108969583 splice site probably benign
R0244:Col7a1 UTSW 9 108972184 splice site probably null
R0331:Col7a1 UTSW 9 108967502 splice site probably benign
R0375:Col7a1 UTSW 9 108980237 missense unknown
R0601:Col7a1 UTSW 9 108980584 splice site probably benign
R0609:Col7a1 UTSW 9 108958147 missense unknown
R0709:Col7a1 UTSW 9 108961548 splice site probably benign
R0879:Col7a1 UTSW 9 108976091 splice site probably benign
R1175:Col7a1 UTSW 9 108955334 missense unknown
R1177:Col7a1 UTSW 9 108962441 missense unknown
R1435:Col7a1 UTSW 9 108963273 missense unknown
R1497:Col7a1 UTSW 9 108978825 missense unknown
R1549:Col7a1 UTSW 9 108955966 missense unknown
R1794:Col7a1 UTSW 9 108965928 missense unknown
R1801:Col7a1 UTSW 9 108960997 missense unknown
R1848:Col7a1 UTSW 9 108969565 missense possibly damaging 0.83
R1899:Col7a1 UTSW 9 108978888 missense unknown
R1944:Col7a1 UTSW 9 108960010 missense unknown
R1945:Col7a1 UTSW 9 108960010 missense unknown
R1955:Col7a1 UTSW 9 108955664 missense unknown
R2009:Col7a1 UTSW 9 108968875 critical splice acceptor site probably null
R2034:Col7a1 UTSW 9 108963007 missense unknown
R3148:Col7a1 UTSW 9 108961405 missense unknown
R3713:Col7a1 UTSW 9 108964440 nonsense probably null
R4078:Col7a1 UTSW 9 108960991 missense unknown
R4193:Col7a1 UTSW 9 108956672 missense unknown
R4232:Col7a1 UTSW 9 108972813 critical splice donor site probably null
R4528:Col7a1 UTSW 9 108959533 missense unknown
R4771:Col7a1 UTSW 9 108971925 missense probably damaging 0.99
R4820:Col7a1 UTSW 9 108968607 missense possibly damaging 0.72
R4896:Col7a1 UTSW 9 108957277 missense unknown
R4911:Col7a1 UTSW 9 108975219 missense unknown
R4915:Col7a1 UTSW 9 108966464 missense unknown
R4917:Col7a1 UTSW 9 108966464 missense unknown
R5001:Col7a1 UTSW 9 108965078 critical splice donor site probably null
R5352:Col7a1 UTSW 9 108961411 missense unknown
R5361:Col7a1 UTSW 9 108963224 missense unknown
R5730:Col7a1 UTSW 9 108972242 critical splice donor site probably null
R5838:Col7a1 UTSW 9 108978143 missense unknown
R5842:Col7a1 UTSW 9 108965815 missense unknown
R5932:Col7a1 UTSW 9 108980211 missense unknown
R6091:Col7a1 UTSW 9 108955334 missense unknown
R6144:Col7a1 UTSW 9 108974080 missense unknown
R6158:Col7a1 UTSW 9 108964603 missense unknown
R6170:Col7a1 UTSW 9 108966443 missense unknown
R6338:Col7a1 UTSW 9 108956633 missense unknown
R6339:Col7a1 UTSW 9 108956633 missense unknown
R6382:Col7a1 UTSW 9 108975393 missense unknown
R6518:Col7a1 UTSW 9 108955527 missense unknown
R6533:Col7a1 UTSW 9 108961358 missense unknown
R6569:Col7a1 UTSW 9 108978110 splice site probably null
R6596:Col7a1 UTSW 9 108954341 unclassified probably benign
R6697:Col7a1 UTSW 9 108970533 missense probably damaging 1.00
R6753:Col7a1 UTSW 9 108958128 missense unknown
R6849:Col7a1 UTSW 9 108975053 missense unknown
R6915:Col7a1 UTSW 9 108967618 missense probably benign 0.02
R6974:Col7a1 UTSW 9 108969426 missense possibly damaging 0.82
R6991:Col7a1 UTSW 9 108983919 critical splice donor site probably null
R7028:Col7a1 UTSW 9 108963263 nonsense probably null
R7556:Col7a1 UTSW 9 108982465 splice site probably null
R7571:Col7a1 UTSW 9 108982707 missense probably null
R7815:Col7a1 UTSW 9 108969565 missense probably damaging 0.96
R7875:Col7a1 UTSW 9 108958695 missense unknown
R7958:Col7a1 UTSW 9 108958695 missense unknown
R8016:Col7a1 UTSW 9 108958644 missense unknown
R8038:Col7a1 UTSW 9 108957292 missense unknown
R8049:Col7a1 UTSW 9 108975563 missense unknown
R8098:Col7a1 UTSW 9 108956695 missense unknown
R8103:Col7a1 UTSW 9 108975384 missense unknown
R8128:Col7a1 UTSW 9 108955721 missense unknown
R8268:Col7a1 UTSW 9 108972989 missense unknown
R8274:Col7a1 UTSW 9 108969961 missense probably damaging 1.00
R8318:Col7a1 UTSW 9 108958374 missense unknown
RF008:Col7a1 UTSW 9 108964479 missense unknown
X0023:Col7a1 UTSW 9 108984185 unclassified probably benign
Z1088:Col7a1 UTSW 9 108978500 splice site silent
Z1177:Col7a1 UTSW 9 108974923 missense unknown
Z1177:Col7a1 UTSW 9 108976051 missense unknown
Z1177:Col7a1 UTSW 9 108984077 missense unknown
Predicted Primers PCR Primer
(F):5'- CAAAGAAGGGGTCATGTTGTATCAG -3'
(R):5'- TAGAGCCATCGTTTCCTCTGG -3'

Sequencing Primer
(F):5'- CATGTTGTATCAGGGCAGGGC -3'
(R):5'- TTCCTCTGGGACCTGGGAAG -3'
Posted On2018-02-28