Incidental Mutation 'R6247:Psme4'
ID 505710
Institutional Source Beutler Lab
Gene Symbol Psme4
Ensembl Gene ENSMUSG00000040850
Gene Name proteasome (prosome, macropain) activator subunit 4
Synonyms
MMRRC Submission 044366-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6247 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 30721726-30830361 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 30803245 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 29 (I29T)
Ref Sequence ENSEMBL: ENSMUSP00000114537 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041231] [ENSMUST00000129824]
AlphaFold Q5SSW2
Predicted Effect probably benign
Transcript: ENSMUST00000041231
AA Change: I1530T

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000045460
Gene: ENSMUSG00000040850
AA Change: I1530T

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 122 133 N/A INTRINSIC
Pfam:BLM10_mid 330 828 8.8e-119 PFAM
SCOP:d1b3ua_ 1183 1716 3e-14 SMART
Pfam:DUF3437 1756 1843 5.3e-39 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000129824
AA Change: I29T

PolyPhen 2 Score 0.601 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele show normal repair of DNA double-strand breaks but exhibit significantly reduced male fertility due to defects in spermatogenesis observed in both meiotic spermatocytes and postmeiotic haploid spermatids. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted, knock-out(1) Gene trapped(24)

Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik T C 11: 72,049,768 (GRCm39) D871G probably benign Het
A4galt G T 15: 83,112,020 (GRCm39) H254Q probably damaging Het
AA986860 C A 1: 130,670,780 (GRCm39) T334K possibly damaging Het
Abca13 T C 11: 9,353,874 (GRCm39) I3732T probably benign Het
Abcf1 C T 17: 36,271,956 (GRCm39) D353N probably damaging Het
Adss1 A G 12: 112,594,790 (GRCm39) H83R probably damaging Het
Amer2 C A 14: 60,616,321 (GRCm39) A172E probably damaging Het
Ankhd1 A G 18: 36,787,199 (GRCm39) T2300A probably benign Het
Ano5 G A 7: 51,215,879 (GRCm39) probably null Het
Apob G A 12: 8,051,801 (GRCm39) G1109D probably damaging Het
Arhgef26 A T 3: 62,288,381 (GRCm39) N484Y probably damaging Het
C6 A G 15: 4,793,023 (GRCm39) D376G probably damaging Het
Caml T C 13: 55,772,986 (GRCm39) probably null Het
Capn12 T C 7: 28,588,077 (GRCm39) L473S probably benign Het
Cdk6 G A 5: 3,394,553 (GRCm39) probably null Het
Cers5 A T 15: 99,643,805 (GRCm39) C153S probably benign Het
Cfap206 T C 4: 34,692,530 (GRCm39) M499V probably benign Het
Chd6 A G 2: 160,791,968 (GRCm39) M2463T probably damaging Het
Chn1 T C 2: 73,537,350 (GRCm39) E58G possibly damaging Het
Clec4a1 T C 6: 122,905,001 (GRCm39) V100A probably benign Het
Col7a1 G C 9: 108,810,130 (GRCm39) probably benign Het
Csmd1 A G 8: 16,246,249 (GRCm39) V1050A possibly damaging Het
Dab1 C T 4: 104,588,948 (GRCm39) A524V probably benign Het
Dennd5a A T 7: 109,497,889 (GRCm39) C1044S probably damaging Het
Dnah7b A G 1: 46,265,048 (GRCm39) T2181A probably benign Het
Dnai1 T C 4: 41,605,775 (GRCm39) V255A probably benign Het
Dync2h1 A G 9: 7,135,078 (GRCm39) C1518R probably damaging Het
Dysf T C 6: 84,043,981 (GRCm39) V273A probably damaging Het
Eif1 C T 11: 100,211,223 (GRCm39) probably benign Het
Eml3 T C 19: 8,908,313 (GRCm39) I58T probably benign Het
Fam171b T A 2: 83,709,552 (GRCm39) I408N probably damaging Het
Fchsd2 A G 7: 100,902,747 (GRCm39) E351G probably benign Het
Focad G A 4: 88,325,377 (GRCm39) A81T possibly damaging Het
Fpr-rs4 G A 17: 18,242,748 (GRCm39) V252I probably benign Het
Fryl A G 5: 73,222,824 (GRCm39) L1919P probably damaging Het
Gm12185 C T 11: 48,806,735 (GRCm39) R152H probably damaging Het
Gm14410 C T 2: 176,885,517 (GRCm39) G249E probably damaging Het
Gm6685 A T 11: 28,289,706 (GRCm39) S37T possibly damaging Het
Greb1 G A 12: 16,766,676 (GRCm39) P374L probably damaging Het
Hdac4 A T 1: 91,940,560 (GRCm39) probably null Het
Hecw1 A T 13: 14,409,010 (GRCm39) L1099* probably null Het
Hivep1 T C 13: 42,310,966 (GRCm39) S1069P probably benign Het
Itgad T C 7: 127,784,959 (GRCm39) I288T possibly damaging Het
Kif9 A G 9: 110,317,612 (GRCm39) M96V possibly damaging Het
Kncn T A 4: 115,741,987 (GRCm39) V18E probably damaging Het
Lrrc74a G A 12: 86,805,330 (GRCm39) G384D probably damaging Het
Ltb4r2 T C 14: 56,000,108 (GRCm39) V243A probably damaging Het
Mtnr1b T A 9: 15,774,082 (GRCm39) I326L probably benign Het
Mylip C T 13: 45,561,957 (GRCm39) T253I probably damaging Het
Necap1 T A 6: 122,857,611 (GRCm39) probably null Het
Nedd4 C T 9: 72,633,720 (GRCm39) P409S probably damaging Het
Npat A T 9: 53,456,538 (GRCm39) E36D probably damaging Het
Ovch2 C T 7: 107,384,648 (GRCm39) V490M probably damaging Het
Pax9 T C 12: 56,756,480 (GRCm39) S273P probably benign Het
Plce1 A G 19: 38,734,289 (GRCm39) E1563G probably damaging Het
Podxl2 C A 6: 88,826,299 (GRCm39) G336* probably null Het
Prdm1 A G 10: 44,322,782 (GRCm39) probably null Het
Ptprd A T 4: 75,984,528 (GRCm39) D780E probably benign Het
Retsat T C 6: 72,581,918 (GRCm39) M294T probably benign Het
Robo2 A T 16: 73,764,672 (GRCm39) V652D probably damaging Het
Rptn C G 3: 93,305,437 (GRCm39) H923Q possibly damaging Het
Serpinb3d G T 1: 107,010,490 (GRCm39) T66K probably benign Het
Setd1b A T 5: 123,296,461 (GRCm39) probably benign Het
Slc7a10 G T 7: 34,886,012 (GRCm39) A36S possibly damaging Het
Sstr3 T A 15: 78,423,788 (GRCm39) I320F probably damaging Het
Syne1 G T 10: 5,299,071 (GRCm39) A1005E probably damaging Het
Syngap1 C A 17: 27,181,931 (GRCm39) S975* probably null Het
Tinagl1 C T 4: 130,066,725 (GRCm39) C124Y probably null Het
Tm9sf1 C T 14: 55,873,827 (GRCm39) R557H probably damaging Het
Tmed2 T A 5: 124,685,055 (GRCm39) I68K possibly damaging Het
Tmem104 A G 11: 115,134,819 (GRCm39) T451A probably benign Het
Tmem141 T C 2: 25,511,693 (GRCm39) probably null Het
Tmem184a C A 5: 139,798,827 (GRCm39) V41L probably benign Het
Tmem39b C T 4: 129,580,584 (GRCm39) V303I possibly damaging Het
Tsn T C 1: 118,232,939 (GRCm39) I122V probably benign Het
Ttc41 G T 10: 86,612,527 (GRCm39) V1267L probably benign Het
Uggt1 A T 1: 36,202,309 (GRCm39) L1096Q probably damaging Het
Usp50 A T 2: 126,617,713 (GRCm39) I244N probably benign Het
Vil1 A G 1: 74,471,498 (GRCm39) S760G probably benign Het
Wasf1 T A 10: 40,813,741 (GRCm39) V541E unknown Het
Zc3h13 G T 14: 75,581,176 (GRCm39) S1721I probably benign Het
Zfp180 G T 7: 23,804,530 (GRCm39) K316N probably damaging Het
Zfp582 T C 7: 6,356,945 (GRCm39) C253R probably damaging Het
Zfp709 TCGACG TCG 8: 72,644,552 (GRCm39) probably benign Het
Zfp759 A G 13: 67,288,524 (GRCm39) T692A probably benign Het
Zfyve26 A G 12: 79,329,758 (GRCm39) V476A probably benign Het
Other mutations in Psme4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Psme4 APN 11 30,765,710 (GRCm39) critical splice donor site probably null
IGL00401:Psme4 APN 11 30,771,079 (GRCm39) splice site probably benign
IGL00475:Psme4 APN 11 30,795,252 (GRCm39) missense probably benign 0.14
IGL00576:Psme4 APN 11 30,773,145 (GRCm39) missense possibly damaging 0.50
IGL00817:Psme4 APN 11 30,770,129 (GRCm39) missense probably benign 0.01
IGL01525:Psme4 APN 11 30,759,936 (GRCm39) splice site probably benign
IGL01862:Psme4 APN 11 30,762,038 (GRCm39) nonsense probably null
IGL02310:Psme4 APN 11 30,787,484 (GRCm39) missense probably benign 0.06
IGL02477:Psme4 APN 11 30,792,083 (GRCm39) missense probably damaging 0.99
IGL02545:Psme4 APN 11 30,791,586 (GRCm39) missense possibly damaging 0.81
IGL02608:Psme4 APN 11 30,770,944 (GRCm39) missense probably benign 0.34
IGL02621:Psme4 APN 11 30,798,131 (GRCm39) missense probably benign
IGL02822:Psme4 APN 11 30,798,204 (GRCm39) unclassified probably benign
IGL02833:Psme4 APN 11 30,800,715 (GRCm39) unclassified probably benign
IGL02964:Psme4 APN 11 30,741,095 (GRCm39) nonsense probably null
IGL03273:Psme4 APN 11 30,798,130 (GRCm39) missense probably damaging 1.00
IGL03348:Psme4 APN 11 30,826,796 (GRCm39) missense probably damaging 1.00
IGL03382:Psme4 APN 11 30,757,788 (GRCm39) missense possibly damaging 0.94
H2330:Psme4 UTSW 11 30,801,210 (GRCm39) missense probably benign 0.17
PIT4378001:Psme4 UTSW 11 30,771,079 (GRCm39) splice site probably benign
R0276:Psme4 UTSW 11 30,761,980 (GRCm39) missense probably damaging 1.00
R0462:Psme4 UTSW 11 30,798,117 (GRCm39) missense probably damaging 1.00
R0685:Psme4 UTSW 11 30,828,415 (GRCm39) missense probably damaging 1.00
R0766:Psme4 UTSW 11 30,757,687 (GRCm39) splice site probably null
R0830:Psme4 UTSW 11 30,757,797 (GRCm39) missense possibly damaging 0.53
R0940:Psme4 UTSW 11 30,765,264 (GRCm39) missense possibly damaging 0.53
R1018:Psme4 UTSW 11 30,754,310 (GRCm39) missense probably damaging 1.00
R1312:Psme4 UTSW 11 30,757,687 (GRCm39) splice site probably null
R1448:Psme4 UTSW 11 30,802,744 (GRCm39) missense probably damaging 1.00
R1713:Psme4 UTSW 11 30,756,310 (GRCm39) missense probably damaging 1.00
R1732:Psme4 UTSW 11 30,798,105 (GRCm39) missense probably benign 0.03
R1813:Psme4 UTSW 11 30,754,353 (GRCm39) missense probably benign 0.14
R1905:Psme4 UTSW 11 30,760,922 (GRCm39) missense probably damaging 1.00
R1907:Psme4 UTSW 11 30,760,922 (GRCm39) missense probably damaging 1.00
R1911:Psme4 UTSW 11 30,765,658 (GRCm39) missense probably benign 0.02
R1956:Psme4 UTSW 11 30,782,424 (GRCm39) missense probably damaging 0.99
R1974:Psme4 UTSW 11 30,769,011 (GRCm39) missense probably benign 0.00
R1980:Psme4 UTSW 11 30,782,615 (GRCm39) missense possibly damaging 0.84
R1986:Psme4 UTSW 11 30,780,352 (GRCm39) missense probably benign 0.01
R2046:Psme4 UTSW 11 30,767,723 (GRCm39) splice site probably benign
R2142:Psme4 UTSW 11 30,770,998 (GRCm39) missense possibly damaging 0.89
R2698:Psme4 UTSW 11 30,824,282 (GRCm39) critical splice donor site probably null
R2844:Psme4 UTSW 11 30,795,173 (GRCm39) splice site probably benign
R3807:Psme4 UTSW 11 30,806,027 (GRCm39) splice site probably null
R3876:Psme4 UTSW 11 30,806,068 (GRCm39) missense probably damaging 0.99
R4420:Psme4 UTSW 11 30,762,028 (GRCm39) missense possibly damaging 0.67
R4584:Psme4 UTSW 11 30,784,318 (GRCm39) missense probably damaging 1.00
R4615:Psme4 UTSW 11 30,784,287 (GRCm39) missense probably benign 0.02
R4714:Psme4 UTSW 11 30,782,573 (GRCm39) missense probably benign 0.02
R5008:Psme4 UTSW 11 30,806,896 (GRCm39) intron probably benign
R5109:Psme4 UTSW 11 30,741,095 (GRCm39) nonsense probably null
R5155:Psme4 UTSW 11 30,826,806 (GRCm39) missense probably damaging 1.00
R5199:Psme4 UTSW 11 30,803,272 (GRCm39) missense probably benign 0.00
R5205:Psme4 UTSW 11 30,782,666 (GRCm39) intron probably benign
R5452:Psme4 UTSW 11 30,741,168 (GRCm39) missense probably benign
R5491:Psme4 UTSW 11 30,765,246 (GRCm39) missense possibly damaging 0.63
R5685:Psme4 UTSW 11 30,759,837 (GRCm39) missense probably damaging 0.99
R5764:Psme4 UTSW 11 30,722,364 (GRCm39) intron probably benign
R5853:Psme4 UTSW 11 30,741,234 (GRCm39) critical splice donor site probably null
R5865:Psme4 UTSW 11 30,741,993 (GRCm39) missense possibly damaging 0.95
R5903:Psme4 UTSW 11 30,791,589 (GRCm39) missense probably benign 0.28
R5927:Psme4 UTSW 11 30,754,294 (GRCm39) missense possibly damaging 0.82
R6004:Psme4 UTSW 11 30,806,896 (GRCm39) intron probably benign
R6102:Psme4 UTSW 11 30,815,567 (GRCm39) missense probably damaging 1.00
R6527:Psme4 UTSW 11 30,782,175 (GRCm39) missense probably benign
R6750:Psme4 UTSW 11 30,803,203 (GRCm39) missense probably damaging 1.00
R6885:Psme4 UTSW 11 30,784,307 (GRCm39) nonsense probably null
R6939:Psme4 UTSW 11 30,787,291 (GRCm39) missense probably damaging 0.99
R6945:Psme4 UTSW 11 30,787,437 (GRCm39) missense probably benign 0.06
R7029:Psme4 UTSW 11 30,722,474 (GRCm39) intron probably benign
R7049:Psme4 UTSW 11 30,763,904 (GRCm39) splice site probably null
R7098:Psme4 UTSW 11 30,800,661 (GRCm39) missense probably damaging 0.99
R7107:Psme4 UTSW 11 30,798,105 (GRCm39) missense probably benign 0.03
R7223:Psme4 UTSW 11 30,824,226 (GRCm39) missense probably benign 0.33
R7319:Psme4 UTSW 11 30,757,790 (GRCm39) missense probably benign 0.00
R7375:Psme4 UTSW 11 30,722,700 (GRCm39) splice site probably null
R7410:Psme4 UTSW 11 30,765,279 (GRCm39) nonsense probably null
R7469:Psme4 UTSW 11 30,752,837 (GRCm39) missense probably benign 0.20
R7651:Psme4 UTSW 11 30,787,334 (GRCm39) missense probably damaging 0.98
R7679:Psme4 UTSW 11 30,828,425 (GRCm39) missense probably damaging 0.99
R7681:Psme4 UTSW 11 30,741,975 (GRCm39) missense possibly damaging 0.63
R7822:Psme4 UTSW 11 30,824,245 (GRCm39) missense probably benign
R8013:Psme4 UTSW 11 30,754,320 (GRCm39) missense probably benign 0.06
R8130:Psme4 UTSW 11 30,792,026 (GRCm39) missense probably damaging 1.00
R8323:Psme4 UTSW 11 30,793,532 (GRCm39) missense probably damaging 0.99
R8330:Psme4 UTSW 11 30,793,583 (GRCm39) missense probably benign 0.00
R8363:Psme4 UTSW 11 30,762,139 (GRCm39) missense probably damaging 1.00
R8491:Psme4 UTSW 11 30,722,161 (GRCm39) missense possibly damaging 0.90
R8690:Psme4 UTSW 11 30,787,319 (GRCm39) missense probably benign 0.00
R8696:Psme4 UTSW 11 30,759,896 (GRCm39) missense probably damaging 0.99
R8743:Psme4 UTSW 11 30,828,467 (GRCm39) missense probably damaging 1.00
R8998:Psme4 UTSW 11 30,788,957 (GRCm39) missense possibly damaging 0.78
R9241:Psme4 UTSW 11 30,815,576 (GRCm39) missense probably damaging 1.00
R9657:Psme4 UTSW 11 30,788,980 (GRCm39) missense probably benign 0.00
R9736:Psme4 UTSW 11 30,797,411 (GRCm39) missense probably damaging 0.99
R9744:Psme4 UTSW 11 30,765,294 (GRCm39) critical splice donor site probably null
R9746:Psme4 UTSW 11 30,826,868 (GRCm39) nonsense probably null
V5088:Psme4 UTSW 11 30,801,210 (GRCm39) missense probably benign 0.17
X0063:Psme4 UTSW 11 30,782,600 (GRCm39) missense possibly damaging 0.66
Z1176:Psme4 UTSW 11 30,793,522 (GRCm39) missense possibly damaging 0.87
Z1177:Psme4 UTSW 11 30,762,138 (GRCm39) missense probably damaging 1.00
Z1177:Psme4 UTSW 11 30,756,311 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGCATATCTTACACTGGGAG -3'
(R):5'- GGTGATGCATGCTTTTAATCCTAAC -3'

Sequencing Primer
(F):5'- CACTGGGAGTGTTCAGAGACC -3'
(R):5'- GCTACCTGGTCAGACAGTATC -3'
Posted On 2018-02-28