Mutagenetix > Incidental Mutation

Incidental Mutation 'R6247:Psme4'

505710

Institutional Source

Beutler Lab

Gene Symbol

Psme4

Ensembl Gene

ENSMUSG00000040850

Gene Name

proteasome (prosome, macropain) activator subunit 4

Synonyms

MMRRC Submission

044366-MU

Accession Numbers

Genbank: NM_134013

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6247 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

30771726-30880361 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 30853245 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 29 (I29T)

Ref Sequence

ENSEMBL: ENSMUSP00000114537 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041231] [ENSMUST00000129824]

AlphaFold

Q5SSW2

Predicted Effect

probably benign
Transcript: ENSMUST00000041231
AA Change: I1530T

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000045460
Gene: ENSMUSG00000040850
AA Change: I1530T

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	122	133	N/A	INTRINSIC
Pfam:BLM10_mid	330	828	8.8e-119	PFAM
SCOP:d1b3ua_	1183	1716	3e-14	SMART
Pfam:DUF3437	1756	1843	5.3e-39	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000129824
AA Change: I29T

PolyPhen 2 Score 0.601 (Sensitivity: 0.87; Specificity: 0.91)

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele show normal repair of DNA double-strand breaks but exhibit significantly reduced male fertility due to defects in spermatogenesis observed in both meiotic spermatocytes and postmeiotic haploid spermatids. [provided by MGI curators]

Allele List at MGI

All alleles(25) : Targeted, knock-out(1) Gene trapped(24)

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933427D14Rik	T	C	11: 72,158,942	D871G	probably benign	Het
A4galt	G	T	15: 83,227,819	H254Q	probably damaging	Het
AA986860	C	A	1: 130,743,043	T334K	possibly damaging	Het
Abca13	T	C	11: 9,403,874	I3732T	probably benign	Het
Abcf1	C	T	17: 35,961,064	D353N	probably damaging	Het
Adssl1	A	G	12: 112,628,356	H83R	probably damaging	Het
Amer2	C	A	14: 60,378,872	A172E	probably damaging	Het
Ankhd1	A	G	18: 36,654,146	T2300A	probably benign	Het
Ano5	G	A	7: 51,566,131		probably null	Het
Apob	G	A	12: 8,001,801	G1109D	probably damaging	Het
Arhgef26	A	T	3: 62,380,960	N484Y	probably damaging	Het
C6	A	G	15: 4,763,541	D376G	probably damaging	Het
Caml	T	C	13: 55,625,173		probably null	Het
Capn12	T	C	7: 28,888,652	L473S	probably benign	Het
Cdk6	G	A	5: 3,344,553		probably null	Het
Cers5	A	T	15: 99,745,924	C153S	probably benign	Het
Cfap206	T	C	4: 34,692,530	M499V	probably benign	Het
Chd6	A	G	2: 160,950,048	M2463T	probably damaging	Het
Chn1	T	C	2: 73,707,006	E58G	possibly damaging	Het
Clec4a1	T	C	6: 122,928,042	V100A	probably benign	Het
Col7a1	G	C	9: 108,981,062		probably benign	Het
Csmd1	A	G	8: 16,196,235	V1050A	possibly damaging	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Dennd5a	A	T	7: 109,898,682	C1044S	probably damaging	Het
Dnah7b	A	G	1: 46,225,888	T2181A	probably benign	Het
Dnaic1	T	C	4: 41,605,775	V255A	probably benign	Het
Dync2h1	A	G	9: 7,135,078	C1518R	probably damaging	Het
Dysf	T	C	6: 84,066,999	V273A	probably damaging	Het
Eif1	C	T	11: 100,320,397		probably benign	Het
Eml3	T	C	19: 8,930,949	I58T	probably benign	Het
Fam171b	T	A	2: 83,879,208	I408N	probably damaging	Het
Fchsd2	A	G	7: 101,253,540	E351G	probably benign	Het
Focad	G	A	4: 88,407,140	A81T	possibly damaging	Het
Fpr-rs4	G	A	17: 18,022,486	V252I	probably benign	Het
Fryl	A	G	5: 73,065,481	L1919P	probably damaging	Het
Gm12185	C	T	11: 48,915,908	R152H	probably damaging	Het
Gm14410	C	T	2: 177,193,724	G249E	probably damaging	Het
Gm3854	T	C	7: 6,353,946	C253R	probably damaging	Het
Gm6685	A	T	11: 28,339,706	S37T	possibly damaging	Het
Greb1	G	A	12: 16,716,675	P374L	probably damaging	Het
Hdac4	A	T	1: 92,012,838		probably null	Het
Hecw1	A	T	13: 14,234,425	L1099*	probably null	Het
Hivep1	T	C	13: 42,157,490	S1069P	probably benign	Het
Itgad	T	C	7: 128,185,787	I288T	possibly damaging	Het
Kif9	A	G	9: 110,488,544	M96V	possibly damaging	Het
Kncn	T	A	4: 115,884,790	V18E	probably damaging	Het
Lrrc74a	G	A	12: 86,758,556	G384D	probably damaging	Het
Ltb4r2	T	C	14: 55,762,651	V243A	probably damaging	Het
Mtnr1b	T	A	9: 15,862,786	I326L	probably benign	Het
Mylip	C	T	13: 45,408,481	T253I	probably damaging	Het
Necap1	T	A	6: 122,880,652		probably null	Het
Nedd4	C	T	9: 72,726,438	P409S	probably damaging	Het
Npat	A	T	9: 53,545,238	E36D	probably damaging	Het
Ovch2	C	T	7: 107,785,441	V490M	probably damaging	Het
Pax9	T	C	12: 56,709,695	S273P	probably benign	Het
Plce1	A	G	19: 38,745,845	E1563G	probably damaging	Het
Podxl2	C	A	6: 88,849,317	G336*	probably null	Het
Prdm1	A	G	10: 44,446,786		probably null	Het
Ptprd	A	T	4: 76,066,291	D780E	probably benign	Het
Retsat	T	C	6: 72,604,935	M294T	probably benign	Het
Robo2	A	T	16: 73,967,784	V652D	probably damaging	Het
Rptn	C	G	3: 93,398,130	H923Q	possibly damaging	Het
Serpinb3d	G	T	1: 107,082,760	T66K	probably benign	Het
Setd1b	A	T	5: 123,158,398		probably benign	Het
Slc7a10	G	T	7: 35,186,587	A36S	possibly damaging	Het
Sstr3	T	A	15: 78,539,588	I320F	probably damaging	Het
Syne1	G	T	10: 5,349,071	A1005E	probably damaging	Het
Syngap1	C	A	17: 26,962,957	S975*	probably null	Het
Tinagl1	C	T	4: 130,172,932	C124Y	probably null	Het
Tm9sf1	C	T	14: 55,636,370	R557H	probably damaging	Het
Tmed2	T	A	5: 124,546,992	I68K	possibly damaging	Het
Tmem104	A	G	11: 115,243,993	T451A	probably benign	Het
Tmem141	T	C	2: 25,621,681		probably null	Het
Tmem184a	C	A	5: 139,813,072	V41L	probably benign	Het
Tmem39b	C	T	4: 129,686,791	V303I	possibly damaging	Het
Tsn	T	C	1: 118,305,209	I122V	probably benign	Het
Ttc41	G	T	10: 86,776,663	V1267L	probably benign	Het
Uggt1	A	T	1: 36,163,228	L1096Q	probably damaging	Het
Usp50	A	T	2: 126,775,793	I244N	probably benign	Het
Vil1	A	G	1: 74,432,339	S760G	probably benign	Het
Wasf1	T	A	10: 40,937,745	V541E	unknown	Het
Zc3h13	G	T	14: 75,343,736	S1721I	probably benign	Het
Zfp180	G	T	7: 24,105,105	K316N	probably damaging	Het
Zfp709	TCGACG	TCG	8: 71,890,708		probably benign	Het
Zfp759	A	G	13: 67,140,460	T692A	probably benign	Het
Zfyve26	A	G	12: 79,282,984	V476A	probably benign	Het

Other mutations in Psme4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00228:Psme4	APN	11	30815710	critical splice donor site	probably null
IGL00401:Psme4	APN	11	30821079	splice site	probably benign
IGL00475:Psme4	APN	11	30845252	missense	probably benign	0.14
IGL00576:Psme4	APN	11	30823145	missense	possibly damaging	0.50
IGL00817:Psme4	APN	11	30820129	missense	probably benign	0.01
IGL01525:Psme4	APN	11	30809936	splice site	probably benign
IGL01862:Psme4	APN	11	30812038	nonsense	probably null
IGL02310:Psme4	APN	11	30837484	missense	probably benign	0.06
IGL02477:Psme4	APN	11	30842083	missense	probably damaging	0.99
IGL02545:Psme4	APN	11	30841586	missense	possibly damaging	0.81
IGL02608:Psme4	APN	11	30820944	missense	probably benign	0.34
IGL02621:Psme4	APN	11	30848131	missense	probably benign
IGL02822:Psme4	APN	11	30848204	unclassified	probably benign
IGL02833:Psme4	APN	11	30850715	unclassified	probably benign
IGL02964:Psme4	APN	11	30791095	nonsense	probably null
IGL03273:Psme4	APN	11	30848130	missense	probably damaging	1.00
IGL03348:Psme4	APN	11	30876796	missense	probably damaging	1.00
IGL03382:Psme4	APN	11	30807788	missense	possibly damaging	0.94
H2330:Psme4	UTSW	11	30851210	missense	probably benign	0.17
PIT4378001:Psme4	UTSW	11	30821079	splice site	probably benign
R0276:Psme4	UTSW	11	30811980	missense	probably damaging	1.00
R0462:Psme4	UTSW	11	30848117	missense	probably damaging	1.00
R0685:Psme4	UTSW	11	30878415	missense	probably damaging	1.00
R0766:Psme4	UTSW	11	30807687	splice site	probably null
R0830:Psme4	UTSW	11	30807797	missense	possibly damaging	0.53
R0940:Psme4	UTSW	11	30815264	missense	possibly damaging	0.53
R1018:Psme4	UTSW	11	30804310	missense	probably damaging	1.00
R1312:Psme4	UTSW	11	30807687	splice site	probably null
R1448:Psme4	UTSW	11	30852744	missense	probably damaging	1.00
R1713:Psme4	UTSW	11	30806310	missense	probably damaging	1.00
R1732:Psme4	UTSW	11	30848105	missense	probably benign	0.03
R1813:Psme4	UTSW	11	30804353	missense	probably benign	0.14
R1905:Psme4	UTSW	11	30810922	missense	probably damaging	1.00
R1907:Psme4	UTSW	11	30810922	missense	probably damaging	1.00
R1911:Psme4	UTSW	11	30815658	missense	probably benign	0.02
R1956:Psme4	UTSW	11	30832424	missense	probably damaging	0.99
R1974:Psme4	UTSW	11	30819011	missense	probably benign	0.00
R1980:Psme4	UTSW	11	30832615	missense	possibly damaging	0.84
R1986:Psme4	UTSW	11	30830352	missense	probably benign	0.01
R2046:Psme4	UTSW	11	30817723	splice site	probably benign
R2142:Psme4	UTSW	11	30820998	missense	possibly damaging	0.89
R2698:Psme4	UTSW	11	30874282	critical splice donor site	probably null
R2844:Psme4	UTSW	11	30845173	splice site	probably benign
R3807:Psme4	UTSW	11	30856027	splice site	probably null
R3876:Psme4	UTSW	11	30856068	missense	probably damaging	0.99
R4420:Psme4	UTSW	11	30812028	missense	possibly damaging	0.67
R4584:Psme4	UTSW	11	30834318	missense	probably damaging	1.00
R4615:Psme4	UTSW	11	30834287	missense	probably benign	0.02
R4714:Psme4	UTSW	11	30832573	missense	probably benign	0.02
R5008:Psme4	UTSW	11	30856896	intron	probably benign
R5109:Psme4	UTSW	11	30791095	nonsense	probably null
R5155:Psme4	UTSW	11	30876806	missense	probably damaging	1.00
R5199:Psme4	UTSW	11	30853272	missense	probably benign	0.00
R5205:Psme4	UTSW	11	30832666	intron	probably benign
R5452:Psme4	UTSW	11	30791168	missense	probably benign
R5491:Psme4	UTSW	11	30815246	missense	possibly damaging	0.63
R5685:Psme4	UTSW	11	30809837	missense	probably damaging	0.99
R5764:Psme4	UTSW	11	30772364	intron	probably benign
R5853:Psme4	UTSW	11	30791234	critical splice donor site	probably null
R5865:Psme4	UTSW	11	30791993	missense	possibly damaging	0.95
R5903:Psme4	UTSW	11	30841589	missense	probably benign	0.28
R5927:Psme4	UTSW	11	30804294	missense	possibly damaging	0.82
R6004:Psme4	UTSW	11	30856896	intron	probably benign
R6102:Psme4	UTSW	11	30865567	missense	probably damaging	1.00
R6527:Psme4	UTSW	11	30832175	missense	probably benign
R6750:Psme4	UTSW	11	30853203	missense	probably damaging	1.00
R6885:Psme4	UTSW	11	30834307	nonsense	probably null
R6939:Psme4	UTSW	11	30837291	missense	probably damaging	0.99
R6945:Psme4	UTSW	11	30837437	missense	probably benign	0.06
R7029:Psme4	UTSW	11	30772474	intron	probably benign
R7049:Psme4	UTSW	11	30813904	splice site	probably null
R7098:Psme4	UTSW	11	30850661	missense	probably damaging	0.99
R7107:Psme4	UTSW	11	30848105	missense	probably benign	0.03
R7223:Psme4	UTSW	11	30874226	missense	probably benign	0.33
R7319:Psme4	UTSW	11	30807790	missense	probably benign	0.00
R7375:Psme4	UTSW	11	30772700	splice site	probably null
R7410:Psme4	UTSW	11	30815279	nonsense	probably null
R7469:Psme4	UTSW	11	30802837	missense	probably benign	0.20
R7651:Psme4	UTSW	11	30837334	missense	probably damaging	0.98
R7679:Psme4	UTSW	11	30878425	missense	probably damaging	0.99
R7681:Psme4	UTSW	11	30791975	missense	possibly damaging	0.63
R7822:Psme4	UTSW	11	30874245	missense	probably benign
R8013:Psme4	UTSW	11	30804320	missense	probably benign	0.06
R8130:Psme4	UTSW	11	30842026	missense	probably damaging	1.00
R8323:Psme4	UTSW	11	30843532	missense	probably damaging	0.99
R8330:Psme4	UTSW	11	30843583	missense	probably benign	0.00
R8363:Psme4	UTSW	11	30812139	missense	probably damaging	1.00
R8491:Psme4	UTSW	11	30772161	missense	possibly damaging	0.90
R8690:Psme4	UTSW	11	30837319	missense	probably benign	0.00
R8696:Psme4	UTSW	11	30809896	missense	probably damaging	0.99
R8743:Psme4	UTSW	11	30878467	missense	probably damaging	1.00
R8998:Psme4	UTSW	11	30838957	missense	possibly damaging	0.78
R9241:Psme4	UTSW	11	30865576	missense	probably damaging	1.00
R9657:Psme4	UTSW	11	30838980	missense	probably benign	0.00
R9736:Psme4	UTSW	11	30847411	missense	probably damaging	0.99
R9744:Psme4	UTSW	11	30815294	critical splice donor site	probably null
R9746:Psme4	UTSW	11	30876868	nonsense	probably null
V5088:Psme4	UTSW	11	30851210	missense	probably benign	0.17
X0063:Psme4	UTSW	11	30832600	missense	possibly damaging	0.66
Z1176:Psme4	UTSW	11	30843522	missense	possibly damaging	0.87
Z1177:Psme4	UTSW	11	30806311	missense	probably damaging	1.00
Z1177:Psme4	UTSW	11	30812138	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGGCATATCTTACACTGGGAG -3'
(R):5'- GGTGATGCATGCTTTTAATCCTAAC -3'

Sequencing Primer
(F):5'- CACTGGGAGTGTTCAGAGACC -3'
(R):5'- GCTACCTGGTCAGACAGTATC -3'

Posted On

2018-02-28