Incidental Mutation 'R6247:Zfyve26'
ID505718
Institutional Source Beutler Lab
Gene Symbol Zfyve26
Ensembl Gene ENSMUSG00000066440
Gene Namezinc finger, FYVE domain containing 26
SynonymsA630028O16Rik, LOC380767, 9330197E15Rik
MMRRC Submission 044366-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6247 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location79232346-79296304 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79282984 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 476 (V476A)
Ref Sequence ENSEMBL: ENSMUSP00000151280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021547] [ENSMUST00000218377]
Predicted Effect probably benign
Transcript: ENSMUST00000021547
AA Change: V476A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000021547
Gene: ENSMUSG00000066440
AA Change: V476A

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
low complexity region 233 244 N/A INTRINSIC
low complexity region 752 775 N/A INTRINSIC
low complexity region 778 796 N/A INTRINSIC
low complexity region 982 1001 N/A INTRINSIC
low complexity region 1073 1091 N/A INTRINSIC
low complexity region 1104 1115 N/A INTRINSIC
low complexity region 1151 1163 N/A INTRINSIC
low complexity region 1177 1192 N/A INTRINSIC
low complexity region 1228 1241 N/A INTRINSIC
low complexity region 1565 1584 N/A INTRINSIC
low complexity region 1743 1770 N/A INTRINSIC
FYVE 1794 1863 1.49e-27 SMART
low complexity region 2486 2498 N/A INTRINSIC
low complexity region 2517 2528 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218377
AA Change: V476A

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219842
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a FYVE zinc finger binding domain. The presence of this domain is thought to target these proteins to membrane lipids through interaction with phospholipids in the membrane. Mutations in this gene are associated with autosomal recessive spastic paraplegia-15. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygoys for a null allele display a late-onset spastic gait disorder with cerebellar ataxia, axon degeneration, and progressive loss of cortical motoneurons and Purkinje cells preceded by accumulation of autofluorescent, electron-dense, membrane-enclosed material in lysosomal structures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik T C 11: 72,158,942 D871G probably benign Het
A4galt G T 15: 83,227,819 H254Q probably damaging Het
AA986860 C A 1: 130,743,043 T334K possibly damaging Het
Abca13 T C 11: 9,403,874 I3732T probably benign Het
Abcf1 C T 17: 35,961,064 D353N probably damaging Het
Adssl1 A G 12: 112,628,356 H83R probably damaging Het
Amer2 C A 14: 60,378,872 A172E probably damaging Het
Ankhd1 A G 18: 36,654,146 T2300A probably benign Het
Ano5 G A 7: 51,566,131 probably null Het
Apob G A 12: 8,001,801 G1109D probably damaging Het
Arhgef26 A T 3: 62,380,960 N484Y probably damaging Het
C6 A G 15: 4,763,541 D376G probably damaging Het
Caml T C 13: 55,625,173 probably null Het
Capn12 T C 7: 28,888,652 L473S probably benign Het
Cdk6 G A 5: 3,344,553 probably null Het
Cers5 A T 15: 99,745,924 C153S probably benign Het
Cfap206 T C 4: 34,692,530 M499V probably benign Het
Chd6 A G 2: 160,950,048 M2463T probably damaging Het
Chn1 T C 2: 73,707,006 E58G possibly damaging Het
Clec4a1 T C 6: 122,928,042 V100A probably benign Het
Col7a1 G C 9: 108,981,062 probably benign Het
Csmd1 A G 8: 16,196,235 V1050A possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dennd5a A T 7: 109,898,682 C1044S probably damaging Het
Dnah7b A G 1: 46,225,888 T2181A probably benign Het
Dnaic1 T C 4: 41,605,775 V255A probably benign Het
Dync2h1 A G 9: 7,135,078 C1518R probably damaging Het
Dysf T C 6: 84,066,999 V273A probably damaging Het
Eif1 C T 11: 100,320,397 probably benign Het
Eml3 T C 19: 8,930,949 I58T probably benign Het
Fam171b T A 2: 83,879,208 I408N probably damaging Het
Fchsd2 A G 7: 101,253,540 E351G probably benign Het
Focad G A 4: 88,407,140 A81T possibly damaging Het
Fpr-rs4 G A 17: 18,022,486 V252I probably benign Het
Fryl A G 5: 73,065,481 L1919P probably damaging Het
Gm12185 C T 11: 48,915,908 R152H probably damaging Het
Gm14410 C T 2: 177,193,724 G249E probably damaging Het
Gm3854 T C 7: 6,353,946 C253R probably damaging Het
Gm6685 A T 11: 28,339,706 S37T possibly damaging Het
Greb1 G A 12: 16,716,675 P374L probably damaging Het
Hdac4 A T 1: 92,012,838 probably null Het
Hecw1 A T 13: 14,234,425 L1099* probably null Het
Hivep1 T C 13: 42,157,490 S1069P probably benign Het
Itgad T C 7: 128,185,787 I288T possibly damaging Het
Kif9 A G 9: 110,488,544 M96V possibly damaging Het
Kncn T A 4: 115,884,790 V18E probably damaging Het
Lrrc74a G A 12: 86,758,556 G384D probably damaging Het
Ltb4r2 T C 14: 55,762,651 V243A probably damaging Het
Mtnr1b T A 9: 15,862,786 I326L probably benign Het
Mylip C T 13: 45,408,481 T253I probably damaging Het
Necap1 T A 6: 122,880,652 probably null Het
Nedd4 C T 9: 72,726,438 P409S probably damaging Het
Npat A T 9: 53,545,238 E36D probably damaging Het
Ovch2 C T 7: 107,785,441 V490M probably damaging Het
Pax9 T C 12: 56,709,695 S273P probably benign Het
Plce1 A G 19: 38,745,845 E1563G probably damaging Het
Podxl2 C A 6: 88,849,317 G336* probably null Het
Prdm1 A G 10: 44,446,786 probably null Het
Psme4 T C 11: 30,853,245 I29T possibly damaging Het
Ptprd A T 4: 76,066,291 D780E probably benign Het
Retsat T C 6: 72,604,935 M294T probably benign Het
Robo2 A T 16: 73,967,784 V652D probably damaging Het
Rptn C G 3: 93,398,130 H923Q possibly damaging Het
Serpinb3d G T 1: 107,082,760 T66K probably benign Het
Setd1b A T 5: 123,158,398 probably benign Het
Slc7a10 G T 7: 35,186,587 A36S possibly damaging Het
Sstr3 T A 15: 78,539,588 I320F probably damaging Het
Syne1 G T 10: 5,349,071 A1005E probably damaging Het
Syngap1 C A 17: 26,962,957 S975* probably null Het
Tinagl1 C T 4: 130,172,932 C124Y probably null Het
Tm9sf1 C T 14: 55,636,370 R557H probably damaging Het
Tmed2 T A 5: 124,546,992 I68K possibly damaging Het
Tmem104 A G 11: 115,243,993 T451A probably benign Het
Tmem141 T C 2: 25,621,681 probably null Het
Tmem184a C A 5: 139,813,072 V41L probably benign Het
Tmem39b C T 4: 129,686,791 V303I possibly damaging Het
Tsn T C 1: 118,305,209 I122V probably benign Het
Ttc41 G T 10: 86,776,663 V1267L probably benign Het
Uggt1 A T 1: 36,163,228 L1096Q probably damaging Het
Usp50 A T 2: 126,775,793 I244N probably benign Het
Vil1 A G 1: 74,432,339 S760G probably benign Het
Wasf1 T A 10: 40,937,745 V541E unknown Het
Zc3h13 G T 14: 75,343,736 S1721I probably benign Het
Zfp180 G T 7: 24,105,105 K316N probably damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Zfp759 A G 13: 67,140,460 T692A probably benign Het
Other mutations in Zfyve26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Zfyve26 APN 12 79249460 unclassified probably benign
IGL00940:Zfyve26 APN 12 79280900 missense probably benign
IGL01148:Zfyve26 APN 12 79260870 missense probably benign 0.01
IGL01347:Zfyve26 APN 12 79252183 intron probably null
IGL01472:Zfyve26 APN 12 79276343 missense probably benign 0.01
IGL01490:Zfyve26 APN 12 79244373 missense probably damaging 1.00
IGL01516:Zfyve26 APN 12 79287851 missense probably benign 0.37
IGL01642:Zfyve26 APN 12 79261574 splice site probably null
IGL01689:Zfyve26 APN 12 79284053 missense possibly damaging 0.71
IGL01877:Zfyve26 APN 12 79287444 missense probably damaging 1.00
IGL01997:Zfyve26 APN 12 79244400 missense probably benign 0.00
IGL02077:Zfyve26 APN 12 79276395 missense possibly damaging 0.54
IGL02437:Zfyve26 APN 12 79268847 missense probably benign 0.01
IGL02933:Zfyve26 APN 12 79280080 missense possibly damaging 0.94
IGL02937:Zfyve26 APN 12 79239020 missense probably benign 0.08
IGL02982:Zfyve26 APN 12 79263870 missense probably damaging 0.99
IGL03064:Zfyve26 APN 12 79261791 missense probably damaging 1.00
IGL03086:Zfyve26 APN 12 79295564 missense probably damaging 0.96
IGL03146:Zfyve26 APN 12 79284072 nonsense probably null
IGL02799:Zfyve26 UTSW 12 79273310 missense probably benign 0.28
R0318:Zfyve26 UTSW 12 79276281 missense probably damaging 1.00
R0513:Zfyve26 UTSW 12 79244484 missense probably damaging 1.00
R0582:Zfyve26 UTSW 12 79246222 missense probably damaging 1.00
R0586:Zfyve26 UTSW 12 79268728 missense possibly damaging 0.96
R0718:Zfyve26 UTSW 12 79265802 splice site probably benign
R0738:Zfyve26 UTSW 12 79295534 missense probably damaging 1.00
R0781:Zfyve26 UTSW 12 79280067 missense probably damaging 0.99
R0894:Zfyve26 UTSW 12 79273598 missense possibly damaging 0.80
R1109:Zfyve26 UTSW 12 79272127 missense probably damaging 1.00
R1110:Zfyve26 UTSW 12 79280067 missense probably damaging 0.99
R1186:Zfyve26 UTSW 12 79263949 missense probably damaging 1.00
R1295:Zfyve26 UTSW 12 79274920 missense probably damaging 1.00
R1430:Zfyve26 UTSW 12 79282817 missense probably benign 0.07
R1439:Zfyve26 UTSW 12 79252163 missense probably benign 0.03
R1517:Zfyve26 UTSW 12 79252151 missense probably damaging 0.98
R1553:Zfyve26 UTSW 12 79287761 missense probably benign 0.00
R1721:Zfyve26 UTSW 12 79261799 missense possibly damaging 0.94
R1758:Zfyve26 UTSW 12 79238944 missense probably damaging 1.00
R1779:Zfyve26 UTSW 12 79278463 missense probably damaging 1.00
R1785:Zfyve26 UTSW 12 79268434 missense possibly damaging 0.48
R1786:Zfyve26 UTSW 12 79268434 missense possibly damaging 0.48
R1826:Zfyve26 UTSW 12 79269049 missense probably damaging 1.00
R1833:Zfyve26 UTSW 12 79286258 missense probably benign 0.36
R1868:Zfyve26 UTSW 12 79261799 missense possibly damaging 0.94
R1900:Zfyve26 UTSW 12 79264351 missense probably damaging 1.00
R1928:Zfyve26 UTSW 12 79239970 nonsense probably null
R1982:Zfyve26 UTSW 12 79255243 missense possibly damaging 0.55
R2062:Zfyve26 UTSW 12 79284032 splice site probably null
R2071:Zfyve26 UTSW 12 79287446 missense possibly damaging 0.95
R2130:Zfyve26 UTSW 12 79268434 missense possibly damaging 0.48
R2132:Zfyve26 UTSW 12 79268434 missense possibly damaging 0.48
R2133:Zfyve26 UTSW 12 79268434 missense possibly damaging 0.48
R2135:Zfyve26 UTSW 12 79246052 missense possibly damaging 0.80
R2207:Zfyve26 UTSW 12 79246087 missense probably damaging 0.99
R2280:Zfyve26 UTSW 12 79275040 missense probably damaging 1.00
R2352:Zfyve26 UTSW 12 79284116 missense probably damaging 1.00
R2398:Zfyve26 UTSW 12 79282799 splice site probably null
R3084:Zfyve26 UTSW 12 79265683 splice site probably benign
R3086:Zfyve26 UTSW 12 79265683 splice site probably benign
R4626:Zfyve26 UTSW 12 79269070 missense possibly damaging 0.95
R4727:Zfyve26 UTSW 12 79244396 missense probably benign 0.16
R4908:Zfyve26 UTSW 12 79249695 intron probably null
R4926:Zfyve26 UTSW 12 79275011 missense probably benign
R4990:Zfyve26 UTSW 12 79287833 missense probably damaging 1.00
R4999:Zfyve26 UTSW 12 79280385 nonsense probably null
R5029:Zfyve26 UTSW 12 79286323 missense probably damaging 0.99
R5070:Zfyve26 UTSW 12 79255361 missense probably damaging 1.00
R5100:Zfyve26 UTSW 12 79280058 nonsense probably null
R5252:Zfyve26 UTSW 12 79268982 missense probably damaging 1.00
R5318:Zfyve26 UTSW 12 79270850 missense probably benign 0.35
R5509:Zfyve26 UTSW 12 79246521 missense probably damaging 1.00
R5574:Zfyve26 UTSW 12 79239924 missense possibly damaging 0.63
R5735:Zfyve26 UTSW 12 79273373 missense probably damaging 0.96
R5756:Zfyve26 UTSW 12 79264357 missense probably damaging 1.00
R5773:Zfyve26 UTSW 12 79287737 missense probably damaging 1.00
R5834:Zfyve26 UTSW 12 79266537 missense probably benign 0.30
R6075:Zfyve26 UTSW 12 79293854 missense possibly damaging 0.74
R6184:Zfyve26 UTSW 12 79268727 missense probably damaging 0.98
R6235:Zfyve26 UTSW 12 79249599 missense probably damaging 1.00
R6320:Zfyve26 UTSW 12 79240002 missense probably damaging 0.97
R6548:Zfyve26 UTSW 12 79238335 missense probably damaging 1.00
R6887:Zfyve26 UTSW 12 79266449 missense probably damaging 1.00
R7133:Zfyve26 UTSW 12 79284152 missense probably benign 0.06
R7152:Zfyve26 UTSW 12 79279114 missense probably benign 0.42
R7165:Zfyve26 UTSW 12 79280405 missense probably damaging 1.00
R7181:Zfyve26 UTSW 12 79268408 missense probably benign 0.00
R7223:Zfyve26 UTSW 12 79246171 missense probably damaging 0.99
R7296:Zfyve26 UTSW 12 79278372 intron probably null
R7299:Zfyve26 UTSW 12 79282984 missense probably benign 0.01
R7301:Zfyve26 UTSW 12 79282984 missense probably benign 0.01
R7302:Zfyve26 UTSW 12 79251168 missense probably damaging 1.00
R7355:Zfyve26 UTSW 12 79240054 missense probably damaging 1.00
R7466:Zfyve26 UTSW 12 79287807 missense probably benign 0.00
R7540:Zfyve26 UTSW 12 79268676 missense probably damaging 0.99
R7552:Zfyve26 UTSW 12 79290957 missense probably damaging 0.97
R7762:Zfyve26 UTSW 12 79268635 missense probably benign 0.02
R7806:Zfyve26 UTSW 12 79280355 critical splice donor site probably null
R7821:Zfyve26 UTSW 12 79255324 missense probably damaging 1.00
RF010:Zfyve26 UTSW 12 79255338 missense probably damaging 1.00
X0020:Zfyve26 UTSW 12 79239005 missense probably damaging 1.00
Z1176:Zfyve26 UTSW 12 79268533 missense probably benign 0.07
Z1177:Zfyve26 UTSW 12 79287375 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- AAGGTGTCTGCGTATGCCAG -3'
(R):5'- AGTGGAGGCCTGCATCAGATAG -3'

Sequencing Primer
(F):5'- AGGGAAGCGCTGTACCTG -3'
(R):5'- CCTGCATCAGATAGAAGGAAGACTG -3'
Posted On2018-02-28