Incidental Mutation 'R6247:Hecw1'
ID505721
Institutional Source Beutler Lab
Gene Symbol Hecw1
Ensembl Gene ENSMUSG00000021301
Gene NameHECT, C2 and WW domain containing E3 ubiquitin protein ligase 1
SynonymsE130207I19Rik, NEDL1
MMRRC Submission 044366-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6247 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location14226438-14523228 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 14234425 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 1099 (L1099*)
Ref Sequence ENSEMBL: ENSMUSP00000152215 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110516] [ENSMUST00000220718]
Predicted Effect probably null
Transcript: ENSMUST00000110516
AA Change: L1526*
SMART Domains Protein: ENSMUSP00000106145
Gene: ENSMUSG00000021301
AA Change: L1526*

DomainStartEndE-ValueType
Pfam:HECW_N 65 184 6.5e-62 PFAM
C2 206 317 1.02e-12 SMART
low complexity region 463 477 N/A INTRINSIC
low complexity region 497 512 N/A INTRINSIC
low complexity region 577 598 N/A INTRINSIC
low complexity region 677 704 N/A INTRINSIC
low complexity region 731 745 N/A INTRINSIC
WW 827 859 8.66e-13 SMART
coiled coil region 873 898 N/A INTRINSIC
low complexity region 917 930 N/A INTRINSIC
WW 1017 1049 5.59e-7 SMART
Blast:HECTc 1137 1192 3e-26 BLAST
low complexity region 1193 1208 N/A INTRINSIC
low complexity region 1212 1223 N/A INTRINSIC
HECTc 1267 1604 1.36e-185 SMART
Predicted Effect probably null
Transcript: ENSMUST00000220718
AA Change: L1099*
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik T C 11: 72,158,942 D871G probably benign Het
A4galt G T 15: 83,227,819 H254Q probably damaging Het
AA986860 C A 1: 130,743,043 T334K possibly damaging Het
Abca13 T C 11: 9,403,874 I3732T probably benign Het
Abcf1 C T 17: 35,961,064 D353N probably damaging Het
Adssl1 A G 12: 112,628,356 H83R probably damaging Het
Amer2 C A 14: 60,378,872 A172E probably damaging Het
Ankhd1 A G 18: 36,654,146 T2300A probably benign Het
Ano5 G A 7: 51,566,131 probably null Het
Apob G A 12: 8,001,801 G1109D probably damaging Het
Arhgef26 A T 3: 62,380,960 N484Y probably damaging Het
C6 A G 15: 4,763,541 D376G probably damaging Het
Caml T C 13: 55,625,173 probably null Het
Capn12 T C 7: 28,888,652 L473S probably benign Het
Cdk6 G A 5: 3,344,553 probably null Het
Cers5 A T 15: 99,745,924 C153S probably benign Het
Cfap206 T C 4: 34,692,530 M499V probably benign Het
Chd6 A G 2: 160,950,048 M2463T probably damaging Het
Chn1 T C 2: 73,707,006 E58G possibly damaging Het
Clec4a1 T C 6: 122,928,042 V100A probably benign Het
Col7a1 G C 9: 108,981,062 probably benign Het
Csmd1 A G 8: 16,196,235 V1050A possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dennd5a A T 7: 109,898,682 C1044S probably damaging Het
Dnah7b A G 1: 46,225,888 T2181A probably benign Het
Dnaic1 T C 4: 41,605,775 V255A probably benign Het
Dync2h1 A G 9: 7,135,078 C1518R probably damaging Het
Dysf T C 6: 84,066,999 V273A probably damaging Het
Eif1 C T 11: 100,320,397 probably benign Het
Eml3 T C 19: 8,930,949 I58T probably benign Het
Fam171b T A 2: 83,879,208 I408N probably damaging Het
Fchsd2 A G 7: 101,253,540 E351G probably benign Het
Focad G A 4: 88,407,140 A81T possibly damaging Het
Fpr-rs4 G A 17: 18,022,486 V252I probably benign Het
Fryl A G 5: 73,065,481 L1919P probably damaging Het
Gm12185 C T 11: 48,915,908 R152H probably damaging Het
Gm14410 C T 2: 177,193,724 G249E probably damaging Het
Gm3854 T C 7: 6,353,946 C253R probably damaging Het
Gm6685 A T 11: 28,339,706 S37T possibly damaging Het
Greb1 G A 12: 16,716,675 P374L probably damaging Het
Hdac4 A T 1: 92,012,838 probably null Het
Hivep1 T C 13: 42,157,490 S1069P probably benign Het
Itgad T C 7: 128,185,787 I288T possibly damaging Het
Kif9 A G 9: 110,488,544 M96V possibly damaging Het
Kncn T A 4: 115,884,790 V18E probably damaging Het
Lrrc74a G A 12: 86,758,556 G384D probably damaging Het
Ltb4r2 T C 14: 55,762,651 V243A probably damaging Het
Mtnr1b T A 9: 15,862,786 I326L probably benign Het
Mylip C T 13: 45,408,481 T253I probably damaging Het
Necap1 T A 6: 122,880,652 probably null Het
Nedd4 C T 9: 72,726,438 P409S probably damaging Het
Npat A T 9: 53,545,238 E36D probably damaging Het
Ovch2 C T 7: 107,785,441 V490M probably damaging Het
Pax9 T C 12: 56,709,695 S273P probably benign Het
Plce1 A G 19: 38,745,845 E1563G probably damaging Het
Podxl2 C A 6: 88,849,317 G336* probably null Het
Prdm1 A G 10: 44,446,786 probably null Het
Psme4 T C 11: 30,853,245 I29T possibly damaging Het
Ptprd A T 4: 76,066,291 D780E probably benign Het
Retsat T C 6: 72,604,935 M294T probably benign Het
Robo2 A T 16: 73,967,784 V652D probably damaging Het
Rptn C G 3: 93,398,130 H923Q possibly damaging Het
Serpinb3d G T 1: 107,082,760 T66K probably benign Het
Setd1b A T 5: 123,158,398 probably benign Het
Slc7a10 G T 7: 35,186,587 A36S possibly damaging Het
Sstr3 T A 15: 78,539,588 I320F probably damaging Het
Syne1 G T 10: 5,349,071 A1005E probably damaging Het
Syngap1 C A 17: 26,962,957 S975* probably null Het
Tinagl1 C T 4: 130,172,932 C124Y probably null Het
Tm9sf1 C T 14: 55,636,370 R557H probably damaging Het
Tmed2 T A 5: 124,546,992 I68K possibly damaging Het
Tmem104 A G 11: 115,243,993 T451A probably benign Het
Tmem141 T C 2: 25,621,681 probably null Het
Tmem184a C A 5: 139,813,072 V41L probably benign Het
Tmem39b C T 4: 129,686,791 V303I possibly damaging Het
Tsn T C 1: 118,305,209 I122V probably benign Het
Ttc41 G T 10: 86,776,663 V1267L probably benign Het
Uggt1 A T 1: 36,163,228 L1096Q probably damaging Het
Usp50 A T 2: 126,775,793 I244N probably benign Het
Vil1 A G 1: 74,432,339 S760G probably benign Het
Wasf1 T A 10: 40,937,745 V541E unknown Het
Zc3h13 G T 14: 75,343,736 S1721I probably benign Het
Zfp180 G T 7: 24,105,105 K316N probably damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Zfp759 A G 13: 67,140,460 T692A probably benign Het
Zfyve26 A G 12: 79,282,984 V476A probably benign Het
Other mutations in Hecw1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00591:Hecw1 APN 13 14265980 missense possibly damaging 0.71
IGL00813:Hecw1 APN 13 14278376 critical splice acceptor site probably null
IGL00843:Hecw1 APN 13 14247573 missense probably benign 0.02
IGL00942:Hecw1 APN 13 14340740 splice site probably benign
IGL00976:Hecw1 APN 13 14318972 missense probably damaging 1.00
IGL01289:Hecw1 APN 13 14264134 missense probably damaging 1.00
IGL01675:Hecw1 APN 13 14234422 missense probably damaging 1.00
IGL01783:Hecw1 APN 13 14278293 missense probably damaging 1.00
IGL01941:Hecw1 APN 13 14316310 missense probably benign 0.01
IGL02170:Hecw1 APN 13 14264158 missense possibly damaging 0.75
IGL02172:Hecw1 APN 13 14264149 missense probably damaging 1.00
IGL02214:Hecw1 APN 13 14300393 missense probably damaging 1.00
IGL02350:Hecw1 APN 13 14248338 splice site probably null
IGL02357:Hecw1 APN 13 14248338 splice site probably null
IGL02372:Hecw1 APN 13 14264121 missense probably damaging 1.00
IGL02591:Hecw1 APN 13 14357236 splice site probably benign
IGL02718:Hecw1 APN 13 14306935 critical splice acceptor site probably null
IGL02795:Hecw1 APN 13 14322517 missense probably damaging 1.00
IGL02941:Hecw1 APN 13 14377726 missense probably damaging 1.00
IGL03256:Hecw1 APN 13 14280484 missense probably damaging 0.99
IGL03256:Hecw1 APN 13 14280485 missense probably benign 0.36
IGL03366:Hecw1 APN 13 14377797 missense probably damaging 1.00
deflated UTSW 13 14247620 missense possibly damaging 0.69
Demoralized UTSW 13 14316818 nonsense probably null
Letdown UTSW 13 14316492 missense probably benign 0.40
IGL03014:Hecw1 UTSW 13 14245808 missense probably damaging 1.00
PIT4378001:Hecw1 UTSW 13 14377783 missense probably damaging 0.98
R0555:Hecw1 UTSW 13 14236941 missense probably damaging 1.00
R0617:Hecw1 UTSW 13 14280442 missense probably benign 0.44
R1476:Hecw1 UTSW 13 14306086 missense probably damaging 1.00
R1479:Hecw1 UTSW 13 14316492 missense probably benign 0.40
R1551:Hecw1 UTSW 13 14316943 missense probably damaging 1.00
R1579:Hecw1 UTSW 13 14377907 missense probably damaging 1.00
R1584:Hecw1 UTSW 13 14340743 critical splice donor site probably null
R1735:Hecw1 UTSW 13 14377765 missense probably null 0.09
R1872:Hecw1 UTSW 13 14280449 nonsense probably null
R1897:Hecw1 UTSW 13 14377940 missense probably damaging 1.00
R2054:Hecw1 UTSW 13 14297413 missense probably damaging 0.97
R2085:Hecw1 UTSW 13 14264087 missense possibly damaging 0.93
R2134:Hecw1 UTSW 13 14377700 missense probably damaging 1.00
R2172:Hecw1 UTSW 13 14377706 missense probably damaging 1.00
R2258:Hecw1 UTSW 13 14316138 missense probably benign 0.01
R2274:Hecw1 UTSW 13 14346068 missense probably benign 0.00
R2275:Hecw1 UTSW 13 14346068 missense probably benign 0.00
R2937:Hecw1 UTSW 13 14245836 missense possibly damaging 0.93
R3830:Hecw1 UTSW 13 14346058 missense probably benign 0.13
R3971:Hecw1 UTSW 13 14236929 missense probably damaging 1.00
R4065:Hecw1 UTSW 13 14316431 missense probably damaging 1.00
R4066:Hecw1 UTSW 13 14316431 missense probably damaging 1.00
R4235:Hecw1 UTSW 13 14317139 missense probably benign 0.42
R4366:Hecw1 UTSW 13 14316164 missense probably damaging 1.00
R4382:Hecw1 UTSW 13 14316164 missense probably damaging 1.00
R4385:Hecw1 UTSW 13 14316164 missense probably damaging 1.00
R4510:Hecw1 UTSW 13 14357191 missense probably damaging 1.00
R4511:Hecw1 UTSW 13 14357191 missense probably damaging 1.00
R4558:Hecw1 UTSW 13 14247605 missense probably damaging 0.99
R4804:Hecw1 UTSW 13 14305985 missense probably benign 0.00
R4854:Hecw1 UTSW 13 14316892 missense probably benign 0.00
R5104:Hecw1 UTSW 13 14340792 missense probably damaging 1.00
R5113:Hecw1 UTSW 13 14346029 missense possibly damaging 0.94
R5167:Hecw1 UTSW 13 14285657 missense probably damaging 1.00
R5392:Hecw1 UTSW 13 14245762 missense probably damaging 1.00
R5394:Hecw1 UTSW 13 14322589 missense probably damaging 1.00
R5504:Hecw1 UTSW 13 14340902 missense probably benign 0.04
R5764:Hecw1 UTSW 13 14322509 missense probably damaging 1.00
R6038:Hecw1 UTSW 13 14346062 missense probably benign 0.28
R6038:Hecw1 UTSW 13 14346062 missense probably benign 0.28
R6228:Hecw1 UTSW 13 14346038 missense probably damaging 1.00
R6252:Hecw1 UTSW 13 14272079 missense probably damaging 0.98
R6291:Hecw1 UTSW 13 14523007 unclassified probably benign
R6321:Hecw1 UTSW 13 14522829 missense probably benign 0.00
R6325:Hecw1 UTSW 13 14316446 missense probably damaging 1.00
R6328:Hecw1 UTSW 13 14247620 missense possibly damaging 0.69
R6557:Hecw1 UTSW 13 14316646 missense possibly damaging 0.78
R6566:Hecw1 UTSW 13 14297283 missense probably damaging 1.00
R6597:Hecw1 UTSW 13 14316818 nonsense probably null
R6821:Hecw1 UTSW 13 14264134 missense probably damaging 1.00
R6914:Hecw1 UTSW 13 14316838 missense probably damaging 0.99
R7078:Hecw1 UTSW 13 14434459 start codon destroyed probably null 0.21
R7114:Hecw1 UTSW 13 14311771 missense probably benign 0.02
R7140:Hecw1 UTSW 13 14316533 missense probably benign
R7150:Hecw1 UTSW 13 14434460 start codon destroyed probably benign
R7288:Hecw1 UTSW 13 14316236 missense probably benign 0.00
R7447:Hecw1 UTSW 13 14357204 missense probably damaging 1.00
R7479:Hecw1 UTSW 13 14340840 missense probably damaging 1.00
R7552:Hecw1 UTSW 13 14316250 missense probably damaging 0.99
R7590:Hecw1 UTSW 13 14264083 missense probably damaging 1.00
R7787:Hecw1 UTSW 13 14318909 missense probably damaging 1.00
R7803:Hecw1 UTSW 13 14234342 missense probably benign 0.25
RF001:Hecw1 UTSW 13 14297424 missense probably damaging 1.00
X0020:Hecw1 UTSW 13 14230723 missense possibly damaging 0.52
X0066:Hecw1 UTSW 13 14280460 missense probably benign 0.13
Z1176:Hecw1 UTSW 13 14300333 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- GCAGTACACTGTGTGACAAGC -3'
(R):5'- CTTGCCTATCTAAATGCCATTATCAGC -3'

Sequencing Primer
(F):5'- AGGAAAGCATGCTTTTTCTCTGCAG -3'
(R):5'- GCAAAATCAAAAAGATCTGAAGTTCC -3'
Posted On2018-02-28