Incidental Mutation 'R6247:C6'
ID505730
Institutional Source Beutler Lab
Gene Symbol C6
Ensembl Gene ENSMUSG00000022181
Gene Namecomplement component 6
Synonyms
MMRRC Submission 044366-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R6247 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location4727175-4814967 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4763541 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 376 (D376G)
Ref Sequence ENSEMBL: ENSMUSP00000124417 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022788] [ENSMUST00000161997] [ENSMUST00000162350] [ENSMUST00000162585]
Predicted Effect probably damaging
Transcript: ENSMUST00000022788
AA Change: D376G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022788
Gene: ENSMUSG00000022181
AA Change: D376G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TSP1 26 79 1.68e-11 SMART
TSP1 84 134 1.05e-3 SMART
LDLa 139 175 1.46e-11 SMART
MACPF 312 516 1.89e-59 SMART
TSP1 568 617 3.9e-7 SMART
CCP 644 699 1.21e-9 SMART
CCP 704 761 3.56e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161997
SMART Domains Protein: ENSMUSP00000125358
Gene: ENSMUSG00000022181

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TSP1 26 79 1.68e-11 SMART
TSP1 84 134 1.05e-3 SMART
LDLa 139 175 1.46e-11 SMART
Blast:TSP1 197 223 3e-9 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000162350
AA Change: D376G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125693
Gene: ENSMUSG00000022181
AA Change: D376G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TSP1 26 79 1.68e-11 SMART
TSP1 84 134 1.05e-3 SMART
LDLa 139 175 1.46e-11 SMART
MACPF 312 516 1.89e-59 SMART
TSP1 568 617 3.9e-7 SMART
CCP 644 699 1.21e-9 SMART
CCP 704 761 3.56e-7 SMART
Blast:FIMAC 859 931 1e-36 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000162585
AA Change: D376G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124417
Gene: ENSMUSG00000022181
AA Change: D376G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TSP1 26 79 1.68e-11 SMART
TSP1 84 134 1.05e-3 SMART
LDLa 139 175 1.46e-11 SMART
MACPF 312 516 1.89e-59 SMART
TSP1 568 617 3.9e-7 SMART
CCP 644 699 1.21e-9 SMART
CCP 704 761 3.56e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162729
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the complement cascade. The encoded protein is part of the membrane attack complex that can be incorporated into the cell membrane and cause cell lysis. Mutations in this gene are associated with complement component-6 deficiency. Transcript variants encoding the same protein have been described.[provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit decreased susceptibility to ischemia reperfusion-induced renal injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik T C 11: 72,158,942 D871G probably benign Het
A4galt G T 15: 83,227,819 H254Q probably damaging Het
AA986860 C A 1: 130,743,043 T334K possibly damaging Het
Abca13 T C 11: 9,403,874 I3732T probably benign Het
Abcf1 C T 17: 35,961,064 D353N probably damaging Het
Adssl1 A G 12: 112,628,356 H83R probably damaging Het
Amer2 C A 14: 60,378,872 A172E probably damaging Het
Ankhd1 A G 18: 36,654,146 T2300A probably benign Het
Ano5 G A 7: 51,566,131 probably null Het
Apob G A 12: 8,001,801 G1109D probably damaging Het
Arhgef26 A T 3: 62,380,960 N484Y probably damaging Het
Caml T C 13: 55,625,173 probably null Het
Capn12 T C 7: 28,888,652 L473S probably benign Het
Cdk6 G A 5: 3,344,553 probably null Het
Cers5 A T 15: 99,745,924 C153S probably benign Het
Cfap206 T C 4: 34,692,530 M499V probably benign Het
Chd6 A G 2: 160,950,048 M2463T probably damaging Het
Chn1 T C 2: 73,707,006 E58G possibly damaging Het
Clec4a1 T C 6: 122,928,042 V100A probably benign Het
Col7a1 G C 9: 108,981,062 probably benign Het
Csmd1 A G 8: 16,196,235 V1050A possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dennd5a A T 7: 109,898,682 C1044S probably damaging Het
Dnah7b A G 1: 46,225,888 T2181A probably benign Het
Dnaic1 T C 4: 41,605,775 V255A probably benign Het
Dync2h1 A G 9: 7,135,078 C1518R probably damaging Het
Dysf T C 6: 84,066,999 V273A probably damaging Het
Eif1 C T 11: 100,320,397 probably benign Het
Eml3 T C 19: 8,930,949 I58T probably benign Het
Fam171b T A 2: 83,879,208 I408N probably damaging Het
Fchsd2 A G 7: 101,253,540 E351G probably benign Het
Focad G A 4: 88,407,140 A81T possibly damaging Het
Fpr-rs4 G A 17: 18,022,486 V252I probably benign Het
Fryl A G 5: 73,065,481 L1919P probably damaging Het
Gm12185 C T 11: 48,915,908 R152H probably damaging Het
Gm14410 C T 2: 177,193,724 G249E probably damaging Het
Gm3854 T C 7: 6,353,946 C253R probably damaging Het
Gm6685 A T 11: 28,339,706 S37T possibly damaging Het
Greb1 G A 12: 16,716,675 P374L probably damaging Het
Hdac4 A T 1: 92,012,838 probably null Het
Hecw1 A T 13: 14,234,425 L1099* probably null Het
Hivep1 T C 13: 42,157,490 S1069P probably benign Het
Itgad T C 7: 128,185,787 I288T possibly damaging Het
Kif9 A G 9: 110,488,544 M96V possibly damaging Het
Kncn T A 4: 115,884,790 V18E probably damaging Het
Lrrc74a G A 12: 86,758,556 G384D probably damaging Het
Ltb4r2 T C 14: 55,762,651 V243A probably damaging Het
Mtnr1b T A 9: 15,862,786 I326L probably benign Het
Mylip C T 13: 45,408,481 T253I probably damaging Het
Necap1 T A 6: 122,880,652 probably null Het
Nedd4 C T 9: 72,726,438 P409S probably damaging Het
Npat A T 9: 53,545,238 E36D probably damaging Het
Ovch2 C T 7: 107,785,441 V490M probably damaging Het
Pax9 T C 12: 56,709,695 S273P probably benign Het
Plce1 A G 19: 38,745,845 E1563G probably damaging Het
Podxl2 C A 6: 88,849,317 G336* probably null Het
Prdm1 A G 10: 44,446,786 probably null Het
Psme4 T C 11: 30,853,245 I29T possibly damaging Het
Ptprd A T 4: 76,066,291 D780E probably benign Het
Retsat T C 6: 72,604,935 M294T probably benign Het
Robo2 A T 16: 73,967,784 V652D probably damaging Het
Rptn C G 3: 93,398,130 H923Q possibly damaging Het
Serpinb3d G T 1: 107,082,760 T66K probably benign Het
Setd1b A T 5: 123,158,398 probably benign Het
Slc7a10 G T 7: 35,186,587 A36S possibly damaging Het
Sstr3 T A 15: 78,539,588 I320F probably damaging Het
Syne1 G T 10: 5,349,071 A1005E probably damaging Het
Syngap1 C A 17: 26,962,957 S975* probably null Het
Tinagl1 C T 4: 130,172,932 C124Y probably null Het
Tm9sf1 C T 14: 55,636,370 R557H probably damaging Het
Tmed2 T A 5: 124,546,992 I68K possibly damaging Het
Tmem104 A G 11: 115,243,993 T451A probably benign Het
Tmem141 T C 2: 25,621,681 probably null Het
Tmem184a C A 5: 139,813,072 V41L probably benign Het
Tmem39b C T 4: 129,686,791 V303I possibly damaging Het
Tsn T C 1: 118,305,209 I122V probably benign Het
Ttc41 G T 10: 86,776,663 V1267L probably benign Het
Uggt1 A T 1: 36,163,228 L1096Q probably damaging Het
Usp50 A T 2: 126,775,793 I244N probably benign Het
Vil1 A G 1: 74,432,339 S760G probably benign Het
Wasf1 T A 10: 40,937,745 V541E unknown Het
Zc3h13 G T 14: 75,343,736 S1721I probably benign Het
Zfp180 G T 7: 24,105,105 K316N probably damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Zfp759 A G 13: 67,140,460 T692A probably benign Het
Zfyve26 A G 12: 79,282,984 V476A probably benign Het
Other mutations in C6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:C6 APN 15 4759967 missense possibly damaging 0.53
IGL00918:C6 APN 15 4735257 missense possibly damaging 0.90
IGL01615:C6 APN 15 4781896 missense probably benign 0.00
IGL01637:C6 APN 15 4759917 missense possibly damaging 0.69
IGL01662:C6 APN 15 4792754 missense probably damaging 1.00
IGL02293:C6 APN 15 4755303 missense probably benign 0.01
IGL02431:C6 APN 15 4759861 nonsense probably null
IGL02568:C6 APN 15 4791164 nonsense probably null
IGL02688:C6 APN 15 4798320 missense probably benign 0.00
IGL02737:C6 APN 15 4796914 missense probably benign 0.30
R0195:C6 UTSW 15 4763471 missense probably benign 0.01
R0334:C6 UTSW 15 4755367 missense probably benign 0.24
R0879:C6 UTSW 15 4763336 splice site probably benign
R0940:C6 UTSW 15 4735235 missense probably benign 0.12
R1342:C6 UTSW 15 4739749 splice site probably benign
R1649:C6 UTSW 15 4735257 missense possibly damaging 0.90
R1709:C6 UTSW 15 4790970 missense probably benign 0.34
R1967:C6 UTSW 15 4759820 missense probably damaging 0.99
R2068:C6 UTSW 15 4791070 missense probably damaging 1.00
R3056:C6 UTSW 15 4739873 missense probably damaging 0.99
R3791:C6 UTSW 15 4735235 missense probably benign 0.00
R3821:C6 UTSW 15 4789584 missense probably benign 0.23
R3895:C6 UTSW 15 4808470 missense probably benign 0.00
R4178:C6 UTSW 15 4735139 missense probably benign 0.02
R4440:C6 UTSW 15 4735251 missense possibly damaging 0.90
R4598:C6 UTSW 15 4763370 missense possibly damaging 0.55
R4632:C6 UTSW 15 4759868 missense probably benign 0.01
R4756:C6 UTSW 15 4781912 missense probably benign
R4879:C6 UTSW 15 4803647 unclassified probably null
R5452:C6 UTSW 15 4814829 missense possibly damaging 0.51
R5538:C6 UTSW 15 4814829 missense possibly damaging 0.84
R5547:C6 UTSW 15 4808488 missense probably benign 0.00
R5790:C6 UTSW 15 4763486 missense probably damaging 1.00
R5862:C6 UTSW 15 4735263 missense possibly damaging 0.66
R5946:C6 UTSW 15 4808514 missense possibly damaging 0.96
R6049:C6 UTSW 15 4735172 missense probably damaging 1.00
R6438:C6 UTSW 15 4796983 missense possibly damaging 0.94
R6873:C6 UTSW 15 4790979 missense probably benign 0.03
R7052:C6 UTSW 15 4733695 missense probably damaging 0.97
R7302:C6 UTSW 15 4796950 missense probably damaging 1.00
R7361:C6 UTSW 15 4796922 nonsense probably null
R7481:C6 UTSW 15 4814875 missense
R7492:C6 UTSW 15 4731714 missense probably benign 0.00
R7498:C6 UTSW 15 4763364 missense probably damaging 1.00
R7569:C6 UTSW 15 4789581 missense probably benign 0.01
R7653:C6 UTSW 15 4814762 missense
R7666:C6 UTSW 15 4789505 missense probably damaging 0.99
R7843:C6 UTSW 15 4808404 missense
R8073:C6 UTSW 15 4735193 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- GCTTTATCAGGATCCATAAGCTG -3'
(R):5'- GACACGCAAACTTTATATGCCC -3'

Sequencing Primer
(F):5'- CAGGATCCATAAGCTGATAAAAGTC -3'
(R):5'- CACTTTTGGGATAGCATTGGAAATG -3'
Posted On2018-02-28