Mutagenetix > Incidental Mutation

Incidental Mutation 'R6246:Dnah14'

505747

Institutional Source

Beutler Lab

Gene Symbol

Dnah14

Ensembl Gene

ENSMUSG00000047369

Gene Name

dynein, axonemal, heavy chain 14

Synonyms

Dnahc14, Gm980, LOC381311, A230079K17Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.068) question?

Stock #

R6246 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

181576559-181815774 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 181680888 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 1877 (I1877T)

Ref Sequence

ENSEMBL: ENSMUSP00000146843 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000208001]

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193365

Predicted Effect

probably benign
Transcript: ENSMUST00000208001
AA Change: I1877T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.6%

Validation Efficiency

100% (78/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. Two major classes of dyneins, axonemal and cytoplasmic, have been identified. DNAH14 is an axonemal dynein heavy chain (DHC) (Vaughan et al., 1996 [PubMed 8812413]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1520401A03Rik	C	A	17: 23,710,491	G315*	probably null	Het
2410089E03Rik	T	A	15: 8,210,014	L1233H	probably damaging	Het
Abca7	T	A	10: 80,015,165	V2110E	probably damaging	Het
Acaca	C	A	11: 84,315,970	T1552K	probably benign	Het
AI314180	A	G	4: 58,811,365		probably null	Het
Aknad1	A	G	3: 108,751,832	D54G	probably damaging	Het
Ano1	T	C	7: 144,633,725	T435A	possibly damaging	Het
Azgp1	A	G	5: 137,985,213	D50G	possibly damaging	Het
Bbx	A	G	16: 50,224,660	S513P	probably benign	Het
Ccdc114	A	G	7: 45,936,364	I116V	probably damaging	Het
Ccdc129	A	T	6: 55,967,672	K459N	probably damaging	Het
Ccdc85a	C	T	11: 28,576,897	S209N	probably damaging	Het
Cdca2	T	A	14: 67,677,828	R661*	probably null	Het
Cdhr2	T	C	13: 54,719,710	V451A	probably damaging	Het
Cenpt	C	T	8: 105,849,259	G152S	possibly damaging	Het
Chd9	A	G	8: 90,932,417	T2A	probably damaging	Het
Chst14	G	A	2: 118,927,001	C117Y	probably damaging	Het
Cic	C	T	7: 25,271,642	T266M	probably damaging	Het
Clec12a	A	T	6: 129,353,770	N105I	possibly damaging	Het
Cmah	G	A	13: 24,466,790	V525M	probably damaging	Het
Cpt1a	T	C	19: 3,376,550	L572P	probably damaging	Het
Crybg2	T	C	4: 134,089,346	L1365P	probably damaging	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Dlg1	G	A	16: 31,665,650	S32N	probably benign	Het
Duox1	G	T	2: 122,327,174	G594C	probably damaging	Het
Eci2	T	C	13: 34,990,198	N127D	probably damaging	Het
Fam57b	T	A	7: 126,827,496	F30L	probably damaging	Het
Fat4	T	C	3: 38,891,721	S1588P	probably damaging	Het
Fer1l4	T	A	2: 156,024,982	I1489F	probably damaging	Het
Flrt3	A	G	2: 140,659,801	Y636H	probably damaging	Het
Frmd5	T	A	2: 121,551,048	H62L	possibly damaging	Het
Gm6309	A	T	5: 146,170,240	Y99N	probably damaging	Het
Gm8225	T	C	17: 26,543,678	V281A	probably benign	Het
Grsf1	A	G	5: 88,662,592	L353P	possibly damaging	Het
Gtf2a1l	A	G	17: 88,671,547	R58G	probably benign	Het
Guf1	G	A	5: 69,558,555	G113R	probably damaging	Het
Hfe	A	T	13: 23,708,229	F51I	probably damaging	Het
Hibch	T	C	1: 52,904,642	S250P	probably damaging	Het
Il1rap	T	A	16: 26,714,881	M509K	probably benign	Het
Il4ra	T	C	7: 125,576,405	V595A	probably benign	Het
Ints11	A	G	4: 155,888,089	T460A	probably benign	Het
Kdm5a	G	A	6: 120,431,910	G1518E	probably damaging	Het
Khsrp	T	C	17: 57,025,324	D289G	possibly damaging	Het
Kif14	C	T	1: 136,476,424	Q29*	probably null	Het
Krt72	T	C	15: 101,780,937	K320R	probably damaging	Het
Lcmt2	A	G	2: 121,140,389	L71P	probably damaging	Het
Lmo7	A	T	14: 101,918,700	D1037V	probably damaging	Het
Lpo	T	C	11: 87,822,232	T15A	unknown	Het
Mia3	G	T	1: 183,345,277	T7N	probably damaging	Het
Muc16	A	T	9: 18,577,067		probably null	Het
Mup9	T	A	4: 60,419,810	Y29F	probably damaging	Het
Nisch	T	C	14: 31,172,559	D1105G	probably damaging	Het
Oip5	T	C	2: 119,615,620	T136A	probably benign	Het
Olfr437	G	A	6: 43,167,502		probably null	Het
Osbpl10	C	A	9: 115,226,774	N532K	probably benign	Het
P2ry12	C	T	3: 59,217,529	V242I	probably benign	Het
Pdhx	A	T	2: 103,046,792	C26S	probably damaging	Het
Pgk2	A	T	17: 40,207,424	I371K	probably damaging	Het
Phyhip	T	C	14: 70,467,055	V238A	probably damaging	Het
Pla2g4a	G	A	1: 149,872,587	T282I	probably damaging	Het
Pld5	A	T	1: 175,963,909	C448*	probably null	Het
Plk1	T	A	7: 122,169,436	I553N	probably damaging	Het
Ppp1r13l	T	A	7: 19,369,858	I88K	probably benign	Het
Rad54l2	A	G	9: 106,700,493		probably null	Het
Sept7	A	G	9: 25,307,521	E428G	probably benign	Het
Serpina3j	G	A	12: 104,317,447	G268D	probably damaging	Het
Smc2	A	T	4: 52,460,289	D555V	probably damaging	Het
Spag16	A	T	1: 69,923,821	I376F	probably benign	Het
Spag6	G	A	2: 18,699,095		probably null	Het
Tecta	T	C	9: 42,377,908	I454V	probably benign	Het
Tm9sf1	C	T	14: 55,636,370	R557H	probably damaging	Het
Traf5	C	T	1: 192,070,553	E28K	probably damaging	Het
Trav23	G	A	14: 53,977,428	E33K	probably damaging	Het
Trim32	T	C	4: 65,614,564	S453P	probably damaging	Het
Tssk1	A	G	16: 17,895,439	T363A	probably benign	Het
Txnrd3	A	G	6: 89,651,541	N88S	probably benign	Het
Unc13b	A	G	4: 43,216,246	S182G	probably benign	Het
Vmn2r89	A	T	14: 51,456,046	R284S	probably damaging	Het
Zbtb14	A	G	17: 69,387,483	T59A	possibly damaging	Het
Zcchc2	T	A	1: 106,030,066	S756T	possibly damaging	Het
Zfp709	TCGACG	TCG	8: 71,890,708		probably benign	Het

Other mutations in Dnah14

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01086:Dnah14	APN	1	181752046	missense	probably benign	0.17
IGL01764:Dnah14	APN	1	181744777	missense	probably benign	0.00
IGL03218:Dnah14	APN	1	181755269	missense	probably benign	0.02
IGL03290:Dnah14	APN	1	181763978	splice site	probably benign
IGL03384:Dnah14	APN	1	181745949	missense	probably benign	0.03
R0009:Dnah14	UTSW	1	181769407	splice site	probably benign
R0125:Dnah14	UTSW	1	181752063	missense	probably damaging	0.99
R0579:Dnah14	UTSW	1	181744747	missense	possibly damaging	0.72
R0973:Dnah14	UTSW	1	181752145	missense	probably damaging	1.00
R0973:Dnah14	UTSW	1	181752145	missense	probably damaging	1.00
R0974:Dnah14	UTSW	1	181752145	missense	probably damaging	1.00
R1609:Dnah14	UTSW	1	181750177	missense	probably damaging	0.97
R1860:Dnah14	UTSW	1	181763960	missense	probably damaging	1.00
R2050:Dnah14	UTSW	1	181752562	missense	probably damaging	1.00
R2974:Dnah14	UTSW	1	181755241	critical splice acceptor site	probably null
R4715:Dnah14	UTSW	1	181757223	missense	probably damaging	1.00
R5076:Dnah14	UTSW	1	181757234	missense	probably benign	0.01
R5424:Dnah14	UTSW	1	181763310	missense	possibly damaging	0.95
R5808:Dnah14	UTSW	1	181741159	missense	possibly damaging	0.72
R5997:Dnah14	UTSW	1	181770105	missense	probably benign	0.00
R6052:Dnah14	UTSW	1	181666487	missense	possibly damaging	0.50
R6061:Dnah14	UTSW	1	181709051	missense	probably damaging	1.00
R6089:Dnah14	UTSW	1	181750154	missense	probably damaging	1.00
R6092:Dnah14	UTSW	1	181621833	missense	probably benign	0.13
R6145:Dnah14	UTSW	1	181666417	missense	probably benign	0.00
R6163:Dnah14	UTSW	1	181666361	missense	probably benign	0.33
R6302:Dnah14	UTSW	1	181601206	missense	possibly damaging	0.96
R6306:Dnah14	UTSW	1	181585024	frame shift	probably null
R6326:Dnah14	UTSW	1	181783556	missense	probably damaging	1.00
R6348:Dnah14	UTSW	1	181626720	missense	possibly damaging	0.83
R6367:Dnah14	UTSW	1	181755386	splice site	probably null
R6376:Dnah14	UTSW	1	181605894	missense	possibly damaging	0.79
R6389:Dnah14	UTSW	1	181651202	critical splice donor site	probably null
R6433:Dnah14	UTSW	1	181651657	missense	probably damaging	0.99
R6454:Dnah14	UTSW	1	181783705	missense	probably damaging	1.00
R6476:Dnah14	UTSW	1	181744768	missense	probably benign	0.26
R6523:Dnah14	UTSW	1	181643621	missense	probably benign	0.00
R6529:Dnah14	UTSW	1	181666469	missense	probably damaging	0.98
R6538:Dnah14	UTSW	1	181584985	missense	unknown
R6546:Dnah14	UTSW	1	181738987	missense	probably damaging	1.00
R6752:Dnah14	UTSW	1	181593452	missense	probably benign	0.07
R6762:Dnah14	UTSW	1	181757259	missense	probably damaging	1.00
R6786:Dnah14	UTSW	1	181641405	missense	probably benign	0.21
R6849:Dnah14	UTSW	1	181808945	missense	probably benign	0.00
R6877:Dnah14	UTSW	1	181628432	missense	possibly damaging	0.82
R6912:Dnah14	UTSW	1	181750183	missense	possibly damaging	0.83
R6919:Dnah14	UTSW	1	181585066	missense	probably benign	0.04
R6924:Dnah14	UTSW	1	181627952	missense	probably benign	0.04
R6957:Dnah14	UTSW	1	181785175	missense	possibly damaging	0.92
R6980:Dnah14	UTSW	1	181648230	missense	probably benign	0.00
R7018:Dnah14	UTSW	1	181626944	missense	possibly damaging	0.55
R7046:Dnah14	UTSW	1	181623003	missense	probably benign	0.01
R7058:Dnah14	UTSW	1	181698049	missense	probably benign	0.00
R7068:Dnah14	UTSW	1	181769790	missense	probably benign	0.35
R7115:Dnah14	UTSW	1	181720145	missense	probably damaging	1.00
R7130:Dnah14	UTSW	1	181745958	nonsense	probably null
R7165:Dnah14	UTSW	1	181704535	missense	probably benign	0.00
R7169:Dnah14	UTSW	1	181702365	missense	probably benign	0.00
R7184:Dnah14	UTSW	1	181704529	nonsense	probably null
R7232:Dnah14	UTSW	1	181757363	missense	probably damaging	1.00
R7260:Dnah14	UTSW	1	181706744	missense	probably damaging	0.99
R7276:Dnah14	UTSW	1	181685807	missense	probably benign	0.41
R7290:Dnah14	UTSW	1	181628174	missense	probably benign	0.20
R7314:Dnah14	UTSW	1	181785254	splice site	probably null
R7326:Dnah14	UTSW	1	181598403	missense	probably benign	0.02
R7336:Dnah14	UTSW	1	181797734	missense	probably damaging	0.96
R7363:Dnah14	UTSW	1	181690524	splice site	probably null
R7371:Dnah14	UTSW	1	181626885	missense	probably benign	0.05
R7376:Dnah14	UTSW	1	181763402	missense	probably benign	0.03
R7418:Dnah14	UTSW	1	181616742	missense	possibly damaging	0.92
R7473:Dnah14	UTSW	1	181752139	missense	probably damaging	0.99
R7514:Dnah14	UTSW	1	181628067	missense	probably damaging	0.96
R7555:Dnah14	UTSW	1	181770054	missense	probably benign	0.26
R7641:Dnah14	UTSW	1	181707533	missense	probably benign	0.01
R7663:Dnah14	UTSW	1	181752155	splice site	probably null
R7674:Dnah14	UTSW	1	181707533	missense	probably benign	0.01
R7680:Dnah14	UTSW	1	181685800	missense	probably benign	0.15
R7709:Dnah14	UTSW	1	181702484	critical splice donor site	probably null
R7842:Dnah14	UTSW	1	181627898	missense	probably damaging	0.99
R7861:Dnah14	UTSW	1	181616759	missense	probably damaging	1.00
R7988:Dnah14	UTSW	1	181783574	missense	probably damaging	0.97
R8016:Dnah14	UTSW	1	181648311	missense	probably benign	0.05
R8042:Dnah14	UTSW	1	181643631	critical splice donor site	probably null
R8071:Dnah14	UTSW	1	181615894	missense	possibly damaging	0.84
R8086:Dnah14	UTSW	1	181766232	missense	probably damaging	1.00
R8095:Dnah14	UTSW	1	181806032	nonsense	probably null
R8139:Dnah14	UTSW	1	181755288	missense	probably damaging	1.00
R8176:Dnah14	UTSW	1	181657033	missense	probably damaging	0.96
R8193:Dnah14	UTSW	1	181688205	missense	probably damaging	1.00
R8197:Dnah14	UTSW	1	181690101	missense	possibly damaging	0.94
R8209:Dnah14	UTSW	1	181795545	missense	possibly damaging	0.69
R8226:Dnah14	UTSW	1	181795545	missense	possibly damaging	0.69
R8251:Dnah14	UTSW	1	181664865	missense	probably damaging	1.00
R8264:Dnah14	UTSW	1	181744792	missense	probably damaging	0.99
R8284:Dnah14	UTSW	1	181773811	missense	probably benign	0.03
R8289:Dnah14	UTSW	1	181716215	nonsense	probably null
R8323:Dnah14	UTSW	1	181704544	missense	probably benign	0.01
R8442:Dnah14	UTSW	1	181741284	missense	probably damaging	0.97
R8458:Dnah14	UTSW	1	181806012	missense
R8507:Dnah14	UTSW	1	181641414	missense	probably benign	0.02
R8509:Dnah14	UTSW	1	181814655	missense
R8520:Dnah14	UTSW	1	181653638	missense	probably damaging	1.00
R8530:Dnah14	UTSW	1	181664946	missense	probably damaging	1.00
R8703:Dnah14	UTSW	1	181666011	nonsense	probably null
R8710:Dnah14	UTSW	1	181690311	missense	probably benign	0.04
R8752:Dnah14	UTSW	1	181628016	missense	probably benign	0.00
R8792:Dnah14	UTSW	1	181814624	missense
R8797:Dnah14	UTSW	1	181637847	missense	probably benign	0.19
R8821:Dnah14	UTSW	1	181792004	nonsense	probably null
R8834:Dnah14	UTSW	1	181616750	missense	possibly damaging	0.83
R8913:Dnah14	UTSW	1	181725498	missense	probably benign	0.01
R8925:Dnah14	UTSW	1	181680756	missense	probably damaging	1.00
R8927:Dnah14	UTSW	1	181680756	missense	probably damaging	1.00
R8934:Dnah14	UTSW	1	181622723	missense	possibly damaging	0.84
R9090:Dnah14	UTSW	1	181769760	missense	probably benign	0.33
R9169:Dnah14	UTSW	1	181605816	missense	probably benign	0.06
R9199:Dnah14	UTSW	1	181651001	missense	possibly damaging	0.50
R9212:Dnah14	UTSW	1	181801287	missense	possibly damaging	0.95
R9213:Dnah14	UTSW	1	181616640	critical splice donor site	probably null
R9271:Dnah14	UTSW	1	181769760	missense	probably benign	0.33
R9282:Dnah14	UTSW	1	181814512	missense
R9350:Dnah14	UTSW	1	181734804	missense	possibly damaging	0.79
R9358:Dnah14	UTSW	1	181709033	missense	probably benign	0.01
R9436:Dnah14	UTSW	1	181680783	missense	probably damaging	1.00
R9484:Dnah14	UTSW	1	181690208	missense	probably benign	0.45
R9484:Dnah14	UTSW	1	181797746	missense	probably benign	0.01
R9486:Dnah14	UTSW	1	181680929	missense	possibly damaging	0.68
R9546:Dnah14	UTSW	1	181593427	critical splice acceptor site	probably null
R9547:Dnah14	UTSW	1	181593427	critical splice acceptor site	probably null
R9578:Dnah14	UTSW	1	181674442	missense	probably benign	0.16
R9654:Dnah14	UTSW	1	181766339	missense	probably benign	0.01
R9681:Dnah14	UTSW	1	181734849	missense	possibly damaging	0.91
R9683:Dnah14	UTSW	1	181598944	missense	probably benign	0.01
R9687:Dnah14	UTSW	1	181598413	missense	probably benign	0.01
R9718:Dnah14	UTSW	1	181622979	missense	probably benign	0.08
R9751:Dnah14	UTSW	1	181792045	missense	probably damaging	1.00
R9757:Dnah14	UTSW	1	181685784	missense	probably benign	0.03
RF007:Dnah14	UTSW	1	181685809	missense	probably benign	0.00
RF012:Dnah14	UTSW	1	181627898	missense	probably damaging	0.99
Z1176:Dnah14	UTSW	1	181757351	missense	possibly damaging	0.83
Z1177:Dnah14	UTSW	1	181690320	missense	probably benign	0.03
Z1177:Dnah14	UTSW	1	181763334	missense	probably damaging	1.00
Z1177:Dnah14	UTSW	1	181766304	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAATATGACTGGATCTCCTGTTCC -3'
(R):5'- CCCTACGGTTTACTGACCAC -3'

Sequencing Primer
(F):5'- CCTGTCCCCAGTCTACAGG -3'
(R):5'- CGGTTTACTGACCACTTAAAAACTC -3'

Posted On

2018-02-28