Incidental Mutation 'R6246:Spag6'
ID505749
Institutional Source Beutler Lab
Gene Symbol Spag6
Ensembl Gene ENSMUSG00000037708
Gene Namesperm associated antigen 6
SynonymsBC061194, Spag6l
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R6246 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location18694032-18750413 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 18699095 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000092751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095132] [ENSMUST00000095132] [ENSMUST00000173763]
Predicted Effect probably null
Transcript: ENSMUST00000095132
SMART Domains Protein: ENSMUSP00000092751
Gene: ENSMUSG00000037708

DomainStartEndE-ValueType
ARM 30 70 2.26e-3 SMART
ARM 114 154 1.67e-6 SMART
ARM 156 196 4.28e-4 SMART
ARM 198 238 5.43e-6 SMART
ARM 240 280 4.6e0 SMART
ARM 282 322 3.09e1 SMART
ARM 323 365 3.93e-3 SMART
Blast:ARM 367 409 7e-17 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000095132
SMART Domains Protein: ENSMUSP00000092751
Gene: ENSMUSG00000037708

DomainStartEndE-ValueType
ARM 30 70 2.26e-3 SMART
ARM 114 154 1.67e-6 SMART
ARM 156 196 4.28e-4 SMART
ARM 198 238 5.43e-6 SMART
ARM 240 280 4.6e0 SMART
ARM 282 322 3.09e1 SMART
ARM 323 365 3.93e-3 SMART
Blast:ARM 367 409 7e-17 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137796
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138017
Predicted Effect probably benign
Transcript: ENSMUST00000173763
SMART Domains Protein: ENSMUSP00000133383
Gene: ENSMUSG00000037708

DomainStartEndE-ValueType
ARM 8 48 2.26e-3 SMART
Blast:ARM 50 90 2e-14 BLAST
ARM 92 132 1.67e-6 SMART
ARM 134 166 5.76e1 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 100% (78/78)
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik C A 17: 23,710,491 G315* probably null Het
2410089E03Rik T A 15: 8,210,014 L1233H probably damaging Het
Abca7 T A 10: 80,015,165 V2110E probably damaging Het
Acaca C A 11: 84,315,970 T1552K probably benign Het
AI314180 A G 4: 58,811,365 probably null Het
Aknad1 A G 3: 108,751,832 D54G probably damaging Het
Ano1 T C 7: 144,633,725 T435A possibly damaging Het
Azgp1 A G 5: 137,985,213 D50G possibly damaging Het
Bbx A G 16: 50,224,660 S513P probably benign Het
Ccdc114 A G 7: 45,936,364 I116V probably damaging Het
Ccdc129 A T 6: 55,967,672 K459N probably damaging Het
Ccdc85a C T 11: 28,576,897 S209N probably damaging Het
Cdca2 T A 14: 67,677,828 R661* probably null Het
Cdhr2 T C 13: 54,719,710 V451A probably damaging Het
Cenpt C T 8: 105,849,259 G152S possibly damaging Het
Chd9 A G 8: 90,932,417 T2A probably damaging Het
Chst14 G A 2: 118,927,001 C117Y probably damaging Het
Cic C T 7: 25,271,642 T266M probably damaging Het
Clec12a A T 6: 129,353,770 N105I possibly damaging Het
Cmah G A 13: 24,466,790 V525M probably damaging Het
Cpt1a T C 19: 3,376,550 L572P probably damaging Het
Crybg2 T C 4: 134,089,346 L1365P probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dlg1 G A 16: 31,665,650 S32N probably benign Het
Dnah14 T C 1: 181,680,888 I1877T probably benign Het
Duox1 G T 2: 122,327,174 G594C probably damaging Het
Eci2 T C 13: 34,990,198 N127D probably damaging Het
Fam57b T A 7: 126,827,496 F30L probably damaging Het
Fat4 T C 3: 38,891,721 S1588P probably damaging Het
Fer1l4 T A 2: 156,024,982 I1489F probably damaging Het
Flrt3 A G 2: 140,659,801 Y636H probably damaging Het
Frmd5 T A 2: 121,551,048 H62L possibly damaging Het
Gm6309 A T 5: 146,170,240 Y99N probably damaging Het
Gm8225 T C 17: 26,543,678 V281A probably benign Het
Grsf1 A G 5: 88,662,592 L353P possibly damaging Het
Gtf2a1l A G 17: 88,671,547 R58G probably benign Het
Guf1 G A 5: 69,558,555 G113R probably damaging Het
Hfe A T 13: 23,708,229 F51I probably damaging Het
Hibch T C 1: 52,904,642 S250P probably damaging Het
Il1rap T A 16: 26,714,881 M509K probably benign Het
Il4ra T C 7: 125,576,405 V595A probably benign Het
Ints11 A G 4: 155,888,089 T460A probably benign Het
Kdm5a G A 6: 120,431,910 G1518E probably damaging Het
Khsrp T C 17: 57,025,324 D289G possibly damaging Het
Kif14 C T 1: 136,476,424 Q29* probably null Het
Krt72 T C 15: 101,780,937 K320R probably damaging Het
Lcmt2 A G 2: 121,140,389 L71P probably damaging Het
Lmo7 A T 14: 101,918,700 D1037V probably damaging Het
Lpo T C 11: 87,822,232 T15A unknown Het
Mia3 G T 1: 183,345,277 T7N probably damaging Het
Muc16 A T 9: 18,577,067 probably null Het
Mup9 T A 4: 60,419,810 Y29F probably damaging Het
Nisch T C 14: 31,172,559 D1105G probably damaging Het
Oip5 T C 2: 119,615,620 T136A probably benign Het
Olfr437 G A 6: 43,167,502 probably null Het
Osbpl10 C A 9: 115,226,774 N532K probably benign Het
P2ry12 C T 3: 59,217,529 V242I probably benign Het
Pdhx A T 2: 103,046,792 C26S probably damaging Het
Pgk2 A T 17: 40,207,424 I371K probably damaging Het
Phyhip T C 14: 70,467,055 V238A probably damaging Het
Pla2g4a G A 1: 149,872,587 T282I probably damaging Het
Pld5 A T 1: 175,963,909 C448* probably null Het
Plk1 T A 7: 122,169,436 I553N probably damaging Het
Ppp1r13l T A 7: 19,369,858 I88K probably benign Het
Rad54l2 A G 9: 106,700,493 probably null Het
Sept7 A G 9: 25,307,521 E428G probably benign Het
Serpina3j G A 12: 104,317,447 G268D probably damaging Het
Smc2 A T 4: 52,460,289 D555V probably damaging Het
Spag16 A T 1: 69,923,821 I376F probably benign Het
Tecta T C 9: 42,377,908 I454V probably benign Het
Tm9sf1 C T 14: 55,636,370 R557H probably damaging Het
Traf5 C T 1: 192,070,553 E28K probably damaging Het
Trav23 G A 14: 53,977,428 E33K probably damaging Het
Trim32 T C 4: 65,614,564 S453P probably damaging Het
Tssk1 A G 16: 17,895,439 T363A probably benign Het
Txnrd3 A G 6: 89,651,541 N88S probably benign Het
Unc13b A G 4: 43,216,246 S182G probably benign Het
Vmn2r89 A T 14: 51,456,046 R284S probably damaging Het
Zbtb14 A G 17: 69,387,483 T59A possibly damaging Het
Zcchc2 T A 1: 106,030,066 S756T possibly damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Other mutations in Spag6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Spag6 APN 2 18734184 missense probably benign 0.31
IGL01352:Spag6 APN 2 18710473 missense possibly damaging 0.77
IGL02795:Spag6 APN 2 18733083 missense probably benign
IGL03406:Spag6 APN 2 18742873 splice site probably benign
R0362:Spag6 UTSW 2 18710491 missense probably damaging 0.99
R0423:Spag6 UTSW 2 18710593 missense probably benign 0.00
R1309:Spag6 UTSW 2 18734216 missense probably damaging 1.00
R1386:Spag6 UTSW 2 18734246 missense possibly damaging 0.49
R1568:Spag6 UTSW 2 18733114 missense probably benign
R1716:Spag6 UTSW 2 18745609 splice site probably null
R1771:Spag6 UTSW 2 18734117 missense probably benign 0.22
R1911:Spag6 UTSW 2 18715805 nonsense probably null
R1985:Spag6 UTSW 2 18732119 missense probably benign 0.00
R2029:Spag6 UTSW 2 18734105 unclassified probably benign
R2131:Spag6 UTSW 2 18733097 nonsense probably null
R3705:Spag6 UTSW 2 18710557 missense probably damaging 0.99
R4230:Spag6 UTSW 2 18715638 splice site probably null
R4585:Spag6 UTSW 2 18732147 critical splice donor site probably null
R4586:Spag6 UTSW 2 18732147 critical splice donor site probably null
R4692:Spag6 UTSW 2 18699243 missense probably benign 0.24
R4745:Spag6 UTSW 2 18737296 missense possibly damaging 0.78
R4890:Spag6 UTSW 2 18742777 missense probably benign 0.00
R4914:Spag6 UTSW 2 18745549 missense probably benign 0.00
R4918:Spag6 UTSW 2 18745549 missense probably benign 0.00
R5086:Spag6 UTSW 2 18742877 splice site probably benign
R5264:Spag6 UTSW 2 18745513 missense probably benign 0.00
R5729:Spag6 UTSW 2 18715714 missense probably benign
R5754:Spag6 UTSW 2 18698802 unclassified probably benign
R5781:Spag6 UTSW 2 18731993 missense probably benign
R5954:Spag6 UTSW 2 18710606 missense probably damaging 1.00
R7607:Spag6 UTSW 2 18731962 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TGTGATGTCATGCCTGGGAC -3'
(R):5'- GAACTTGGCACCACTTTAGCC -3'

Sequencing Primer
(F):5'- ATGTCATGCCTGGGACTTAAC -3'
(R):5'- TCCCATGAGCTGTGAAGGC -3'
Posted On2018-02-28