Incidental Mutation 'R6246:Guf1'
ID505769
Institutional Source Beutler Lab
Gene Symbol Guf1
Ensembl Gene ENSMUSG00000029208
Gene NameGUF1 homolog, GTPase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.801) question?
Stock #R6246 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location69556923-69575973 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 69558555 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 113 (G113R)
Ref Sequence ENSEMBL: ENSMUSP00000144246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031113] [ENSMUST00000087228] [ENSMUST00000132169] [ENSMUST00000144363] [ENSMUST00000154728] [ENSMUST00000173205]
Predicted Effect probably damaging
Transcript: ENSMUST00000031113
AA Change: G113R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000031113
Gene: ENSMUSG00000029208
AA Change: G113R

DomainStartEndE-ValueType
low complexity region 7 29 N/A INTRINSIC
Pfam:GTP_EFTU 48 227 2.9e-53 PFAM
Pfam:MMR_HSR1 52 177 1.1e-7 PFAM
Pfam:Ras 83 227 2.4e-7 PFAM
low complexity region 336 349 N/A INTRINSIC
EFG_C 364 450 9.13e-1 SMART
Pfam:LepA_C 452 559 3.1e-48 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000087228
AA Change: G113R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000084480
Gene: ENSMUSG00000029208
AA Change: G113R

DomainStartEndE-ValueType
low complexity region 7 29 N/A INTRINSIC
Pfam:GTP_EFTU 48 227 3.1e-54 PFAM
Pfam:MMR_HSR1 52 177 4.1e-6 PFAM
Pfam:Ras 83 226 2.9e-7 PFAM
Pfam:GTP_EFTU_D2 250 320 7e-10 PFAM
low complexity region 424 437 N/A INTRINSIC
EFG_C 452 538 9.13e-1 SMART
Pfam:LepA_C 540 646 1.3e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125543
Predicted Effect probably damaging
Transcript: ENSMUST00000132169
AA Change: G113R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144290
Gene: ENSMUSG00000029208
AA Change: G113R

DomainStartEndE-ValueType
low complexity region 7 29 N/A INTRINSIC
Pfam:GTP_EFTU 48 227 6.2e-54 PFAM
Pfam:MMR_HSR1 52 177 6.2e-6 PFAM
Pfam:Ras 83 226 1.2e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000144363
AA Change: G107R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114707
Gene: ENSMUSG00000029208
AA Change: G107R

DomainStartEndE-ValueType
low complexity region 1 23 N/A INTRINSIC
Pfam:GTP_EFTU 42 221 5.8e-54 PFAM
Pfam:MMR_HSR1 46 171 5.9e-6 PFAM
Pfam:Ras 77 220 1.1e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000154728
AA Change: G113R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144246
Gene: ENSMUSG00000029208
AA Change: G113R

DomainStartEndE-ValueType
low complexity region 7 29 N/A INTRINSIC
Pfam:GTP_EFTU 48 227 6.2e-54 PFAM
Pfam:MMR_HSR1 52 177 6.2e-6 PFAM
Pfam:Ras 83 226 1.2e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000173205
AA Change: G100R

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000133467
Gene: ENSMUSG00000029208
AA Change: G100R

DomainStartEndE-ValueType
Pfam:GTP_EFTU 11 190 1.1e-53 PFAM
Pfam:MMR_HSR1 15 140 2.6e-8 PFAM
Pfam:Ras 46 190 1.6e-7 PFAM
Pfam:GTP_EFTU_D2 213 283 3.1e-9 PFAM
Pfam:EFG_C 369 454 1e-16 PFAM
Pfam:LepA_C 455 562 4.5e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201115
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GTPase that triggers back-translocation of the elongating ribosome during mitochondrial protein synthesis. The protein contains a highly conserved C-terminal domain not found in other GTPases that facilitates tRNA binding. The encoded protein is thought to prevent misincorporation of amino acids in stressful, suboptimal conditions. An allelic variant in this gene has been associated with early infantile epileptic encephalopathy-40. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik C A 17: 23,710,491 G315* probably null Het
2410089E03Rik T A 15: 8,210,014 L1233H probably damaging Het
Abca7 T A 10: 80,015,165 V2110E probably damaging Het
Acaca C A 11: 84,315,970 T1552K probably benign Het
AI314180 A G 4: 58,811,365 probably null Het
Aknad1 A G 3: 108,751,832 D54G probably damaging Het
Ano1 T C 7: 144,633,725 T435A possibly damaging Het
Azgp1 A G 5: 137,985,213 D50G possibly damaging Het
Bbx A G 16: 50,224,660 S513P probably benign Het
Ccdc114 A G 7: 45,936,364 I116V probably damaging Het
Ccdc129 A T 6: 55,967,672 K459N probably damaging Het
Ccdc85a C T 11: 28,576,897 S209N probably damaging Het
Cdca2 T A 14: 67,677,828 R661* probably null Het
Cdhr2 T C 13: 54,719,710 V451A probably damaging Het
Cenpt C T 8: 105,849,259 G152S possibly damaging Het
Chd9 A G 8: 90,932,417 T2A probably damaging Het
Chst14 G A 2: 118,927,001 C117Y probably damaging Het
Cic C T 7: 25,271,642 T266M probably damaging Het
Clec12a A T 6: 129,353,770 N105I possibly damaging Het
Cmah G A 13: 24,466,790 V525M probably damaging Het
Cpt1a T C 19: 3,376,550 L572P probably damaging Het
Crybg2 T C 4: 134,089,346 L1365P probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dlg1 G A 16: 31,665,650 S32N probably benign Het
Dnah14 T C 1: 181,680,888 I1877T probably benign Het
Duox1 G T 2: 122,327,174 G594C probably damaging Het
Eci2 T C 13: 34,990,198 N127D probably damaging Het
Fam57b T A 7: 126,827,496 F30L probably damaging Het
Fat4 T C 3: 38,891,721 S1588P probably damaging Het
Fer1l4 T A 2: 156,024,982 I1489F probably damaging Het
Flrt3 A G 2: 140,659,801 Y636H probably damaging Het
Frmd5 T A 2: 121,551,048 H62L possibly damaging Het
Gm6309 A T 5: 146,170,240 Y99N probably damaging Het
Gm8225 T C 17: 26,543,678 V281A probably benign Het
Grsf1 A G 5: 88,662,592 L353P possibly damaging Het
Gtf2a1l A G 17: 88,671,547 R58G probably benign Het
Hfe A T 13: 23,708,229 F51I probably damaging Het
Hibch T C 1: 52,904,642 S250P probably damaging Het
Il1rap T A 16: 26,714,881 M509K probably benign Het
Il4ra T C 7: 125,576,405 V595A probably benign Het
Ints11 A G 4: 155,888,089 T460A probably benign Het
Kdm5a G A 6: 120,431,910 G1518E probably damaging Het
Khsrp T C 17: 57,025,324 D289G possibly damaging Het
Kif14 C T 1: 136,476,424 Q29* probably null Het
Krt72 T C 15: 101,780,937 K320R probably damaging Het
Lcmt2 A G 2: 121,140,389 L71P probably damaging Het
Lmo7 A T 14: 101,918,700 D1037V probably damaging Het
Lpo T C 11: 87,822,232 T15A unknown Het
Mia3 G T 1: 183,345,277 T7N probably damaging Het
Muc16 A T 9: 18,577,067 probably null Het
Mup9 T A 4: 60,419,810 Y29F probably damaging Het
Nisch T C 14: 31,172,559 D1105G probably damaging Het
Oip5 T C 2: 119,615,620 T136A probably benign Het
Olfr437 G A 6: 43,167,502 probably null Het
Osbpl10 C A 9: 115,226,774 N532K probably benign Het
P2ry12 C T 3: 59,217,529 V242I probably benign Het
Pdhx A T 2: 103,046,792 C26S probably damaging Het
Pgk2 A T 17: 40,207,424 I371K probably damaging Het
Phyhip T C 14: 70,467,055 V238A probably damaging Het
Pla2g4a G A 1: 149,872,587 T282I probably damaging Het
Pld5 A T 1: 175,963,909 C448* probably null Het
Plk1 T A 7: 122,169,436 I553N probably damaging Het
Ppp1r13l T A 7: 19,369,858 I88K probably benign Het
Rad54l2 A G 9: 106,700,493 probably null Het
Sept7 A G 9: 25,307,521 E428G probably benign Het
Serpina3j G A 12: 104,317,447 G268D probably damaging Het
Smc2 A T 4: 52,460,289 D555V probably damaging Het
Spag16 A T 1: 69,923,821 I376F probably benign Het
Spag6 G A 2: 18,699,095 probably null Het
Tecta T C 9: 42,377,908 I454V probably benign Het
Tm9sf1 C T 14: 55,636,370 R557H probably damaging Het
Traf5 C T 1: 192,070,553 E28K probably damaging Het
Trav23 G A 14: 53,977,428 E33K probably damaging Het
Trim32 T C 4: 65,614,564 S453P probably damaging Het
Tssk1 A G 16: 17,895,439 T363A probably benign Het
Txnrd3 A G 6: 89,651,541 N88S probably benign Het
Unc13b A G 4: 43,216,246 S182G probably benign Het
Vmn2r89 A T 14: 51,456,046 R284S probably damaging Het
Zbtb14 A G 17: 69,387,483 T59A possibly damaging Het
Zcchc2 T A 1: 106,030,066 S756T possibly damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Other mutations in Guf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01580:Guf1 APN 5 69565421 splice site probably benign
IGL01739:Guf1 APN 5 69561158 missense probably damaging 1.00
IGL03110:Guf1 APN 5 69558477 missense probably damaging 1.00
R0054:Guf1 UTSW 5 69559561 synonymous silent
R0219:Guf1 UTSW 5 69559586 missense probably damaging 1.00
R0269:Guf1 UTSW 5 69559599 missense probably damaging 0.99
R0624:Guf1 UTSW 5 69558580 missense probably damaging 1.00
R0690:Guf1 UTSW 5 69566352 intron probably null
R0906:Guf1 UTSW 5 69566386 missense probably damaging 0.99
R1082:Guf1 UTSW 5 69567212 missense possibly damaging 0.95
R1386:Guf1 UTSW 5 69563162 missense probably benign
R1506:Guf1 UTSW 5 69567166 missense possibly damaging 0.85
R1859:Guf1 UTSW 5 69568460 nonsense probably null
R1982:Guf1 UTSW 5 69567226 nonsense probably null
R3782:Guf1 UTSW 5 69567152 missense probably benign 0.01
R3847:Guf1 UTSW 5 69561157 missense probably damaging 0.99
R4172:Guf1 UTSW 5 69558229 missense possibly damaging 0.88
R4513:Guf1 UTSW 5 69561662 missense probably benign 0.00
R4592:Guf1 UTSW 5 69566443 missense possibly damaging 0.55
R4811:Guf1 UTSW 5 69564509 splice site probably null
R5435:Guf1 UTSW 5 69563169 missense probably benign 0.01
R5792:Guf1 UTSW 5 69560486 missense probably damaging 1.00
R6181:Guf1 UTSW 5 69561716 missense probably damaging 1.00
R6411:Guf1 UTSW 5 69560511 missense possibly damaging 0.87
R6701:Guf1 UTSW 5 69558253 missense probably damaging 1.00
R6724:Guf1 UTSW 5 69566393 missense probably damaging 0.99
R7634:Guf1 UTSW 5 69564544 missense probably damaging 0.97
X0018:Guf1 UTSW 5 69566366 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCGCAATATCTTACCTTTAGGC -3'
(R):5'- GAACTGCTAGTCTACTGATATGACG -3'

Sequencing Primer
(F):5'- CTAGGAACAATTGATAAGACG -3'
(R):5'- GTGATTTTTGTGAAAACAATGGAAAC -3'
Posted On2018-02-28