Mutagenetix > Incidental Mutation

Incidental Mutation 'R6246:Clec12a'

505777

Institutional Source

Beutler Lab

Gene Symbol

Clec12a

Ensembl Gene

ENSMUSG00000053063

Gene Name

C-type lectin domain family 12, member a

Synonyms

Micl

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.065) question?

Stock #

R6246 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

129342691-129365303 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 129353770 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 105 (N105I)

Ref Sequence

ENSEMBL: ENSMUSP00000063627 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065289] [ENSMUST00000151671]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000065289
AA Change: N105I

PolyPhen 2 Score 0.844 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000063627
Gene: ENSMUSG00000053063
AA Change: N105I

Domain	Start	End	E-Value	Type
transmembrane domain	43	65	N/A	INTRINSIC
CLECT	133	247	1.22e-5	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133756

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147106

Predicted Effect

possibly damaging
Transcript: ENSMUST00000151671
AA Change: N105I

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000118315
Gene: ENSMUSG00000053063
AA Change: N105I

Domain	Start	End	E-Value	Type
transmembrane domain	43	65	N/A	INTRINSIC
SCOP:d2afpa_	127	179	6e-8	SMART
Blast:CLECT	136	179	3e-24	BLAST

Meta Mutation Damage Score

0.2190

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.6%

Validation Efficiency

100% (78/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signaling, glycoprotein turnover, and roles in inflammation and immune response. The protein encoded by this gene is a negative regulator of granulocyte and monocyte function. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. This gene is closely linked to other CTL/CTLD superfamily members in the natural killer gene complex region on chromosome 12p13. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit hyperinflammatory responses following challenge with uric acid crystals (monosodium urate) or necrotic cells and after radiation-induced thymocyte killing. Homozygotes for a different null allele show increased susceptibility to bacterial infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1520401A03Rik	C	A	17: 23,710,491	G315*	probably null	Het
2410089E03Rik	T	A	15: 8,210,014	L1233H	probably damaging	Het
Abca7	T	A	10: 80,015,165	V2110E	probably damaging	Het
Acaca	C	A	11: 84,315,970	T1552K	probably benign	Het
AI314180	A	G	4: 58,811,365		probably null	Het
Aknad1	A	G	3: 108,751,832	D54G	probably damaging	Het
Ano1	T	C	7: 144,633,725	T435A	possibly damaging	Het
Azgp1	A	G	5: 137,985,213	D50G	possibly damaging	Het
Bbx	A	G	16: 50,224,660	S513P	probably benign	Het
Ccdc114	A	G	7: 45,936,364	I116V	probably damaging	Het
Ccdc129	A	T	6: 55,967,672	K459N	probably damaging	Het
Ccdc85a	C	T	11: 28,576,897	S209N	probably damaging	Het
Cdca2	T	A	14: 67,677,828	R661*	probably null	Het
Cdhr2	T	C	13: 54,719,710	V451A	probably damaging	Het
Cenpt	C	T	8: 105,849,259	G152S	possibly damaging	Het
Chd9	A	G	8: 90,932,417	T2A	probably damaging	Het
Chst14	G	A	2: 118,927,001	C117Y	probably damaging	Het
Cic	C	T	7: 25,271,642	T266M	probably damaging	Het
Cmah	G	A	13: 24,466,790	V525M	probably damaging	Het
Cpt1a	T	C	19: 3,376,550	L572P	probably damaging	Het
Crybg2	T	C	4: 134,089,346	L1365P	probably damaging	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Dlg1	G	A	16: 31,665,650	S32N	probably benign	Het
Dnah14	T	C	1: 181,680,888	I1877T	probably benign	Het
Duox1	G	T	2: 122,327,174	G594C	probably damaging	Het
Eci2	T	C	13: 34,990,198	N127D	probably damaging	Het
Fam57b	T	A	7: 126,827,496	F30L	probably damaging	Het
Fat4	T	C	3: 38,891,721	S1588P	probably damaging	Het
Fer1l4	T	A	2: 156,024,982	I1489F	probably damaging	Het
Flrt3	A	G	2: 140,659,801	Y636H	probably damaging	Het
Frmd5	T	A	2: 121,551,048	H62L	possibly damaging	Het
Gm6309	A	T	5: 146,170,240	Y99N	probably damaging	Het
Gm8225	T	C	17: 26,543,678	V281A	probably benign	Het
Grsf1	A	G	5: 88,662,592	L353P	possibly damaging	Het
Gtf2a1l	A	G	17: 88,671,547	R58G	probably benign	Het
Guf1	G	A	5: 69,558,555	G113R	probably damaging	Het
Hfe	A	T	13: 23,708,229	F51I	probably damaging	Het
Hibch	T	C	1: 52,904,642	S250P	probably damaging	Het
Il1rap	T	A	16: 26,714,881	M509K	probably benign	Het
Il4ra	T	C	7: 125,576,405	V595A	probably benign	Het
Ints11	A	G	4: 155,888,089	T460A	probably benign	Het
Kdm5a	G	A	6: 120,431,910	G1518E	probably damaging	Het
Khsrp	T	C	17: 57,025,324	D289G	possibly damaging	Het
Kif14	C	T	1: 136,476,424	Q29*	probably null	Het
Krt72	T	C	15: 101,780,937	K320R	probably damaging	Het
Lcmt2	A	G	2: 121,140,389	L71P	probably damaging	Het
Lmo7	A	T	14: 101,918,700	D1037V	probably damaging	Het
Lpo	T	C	11: 87,822,232	T15A	unknown	Het
Mia3	G	T	1: 183,345,277	T7N	probably damaging	Het
Muc16	A	T	9: 18,577,067		probably null	Het
Mup9	T	A	4: 60,419,810	Y29F	probably damaging	Het
Nisch	T	C	14: 31,172,559	D1105G	probably damaging	Het
Oip5	T	C	2: 119,615,620	T136A	probably benign	Het
Olfr437	G	A	6: 43,167,502		probably null	Het
Osbpl10	C	A	9: 115,226,774	N532K	probably benign	Het
P2ry12	C	T	3: 59,217,529	V242I	probably benign	Het
Pdhx	A	T	2: 103,046,792	C26S	probably damaging	Het
Pgk2	A	T	17: 40,207,424	I371K	probably damaging	Het
Phyhip	T	C	14: 70,467,055	V238A	probably damaging	Het
Pla2g4a	G	A	1: 149,872,587	T282I	probably damaging	Het
Pld5	A	T	1: 175,963,909	C448*	probably null	Het
Plk1	T	A	7: 122,169,436	I553N	probably damaging	Het
Ppp1r13l	T	A	7: 19,369,858	I88K	probably benign	Het
Rad54l2	A	G	9: 106,700,493		probably null	Het
Sept7	A	G	9: 25,307,521	E428G	probably benign	Het
Serpina3j	G	A	12: 104,317,447	G268D	probably damaging	Het
Smc2	A	T	4: 52,460,289	D555V	probably damaging	Het
Spag16	A	T	1: 69,923,821	I376F	probably benign	Het
Spag6	G	A	2: 18,699,095		probably null	Het
Tecta	T	C	9: 42,377,908	I454V	probably benign	Het
Tm9sf1	C	T	14: 55,636,370	R557H	probably damaging	Het
Traf5	C	T	1: 192,070,553	E28K	probably damaging	Het
Trav23	G	A	14: 53,977,428	E33K	probably damaging	Het
Trim32	T	C	4: 65,614,564	S453P	probably damaging	Het
Tssk1	A	G	16: 17,895,439	T363A	probably benign	Het
Txnrd3	A	G	6: 89,651,541	N88S	probably benign	Het
Unc13b	A	G	4: 43,216,246	S182G	probably benign	Het
Vmn2r89	A	T	14: 51,456,046	R284S	probably damaging	Het
Zbtb14	A	G	17: 69,387,483	T59A	possibly damaging	Het
Zcchc2	T	A	1: 106,030,066	S756T	possibly damaging	Het
Zfp709	TCGACG	TCG	8: 71,890,708		probably benign	Het

Other mutations in Clec12a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02370:Clec12a	APN	6	129354576	missense	possibly damaging	0.58
R0491:Clec12a	UTSW	6	129364053	missense	probably benign	0.01
R1551:Clec12a	UTSW	6	129350421	start codon destroyed	probably damaging	1.00
R1827:Clec12a	UTSW	6	129353799	missense	probably damaging	1.00
R1828:Clec12a	UTSW	6	129353799	missense	probably damaging	1.00
R1959:Clec12a	UTSW	6	129350481	missense	possibly damaging	0.91
R1961:Clec12a	UTSW	6	129350481	missense	possibly damaging	0.91
R4280:Clec12a	UTSW	6	129363929	missense	probably damaging	1.00
R4392:Clec12a	UTSW	6	129353464	splice site	probably benign
R4658:Clec12a	UTSW	6	129354530	missense	probably damaging	1.00
R4922:Clec12a	UTSW	6	129359478	missense	probably damaging	1.00
R4959:Clec12a	UTSW	6	129353665	missense	probably benign	0.10
R4973:Clec12a	UTSW	6	129353665	missense	probably benign	0.10
R6450:Clec12a	UTSW	6	129353403	missense	probably damaging	1.00
R7494:Clec12a	UTSW	6	129353399	missense	possibly damaging	0.53
R8946:Clec12a	UTSW	6	129363986	missense	possibly damaging	0.70
R9678:Clec12a	UTSW	6	129353665	missense	probably benign	0.10

Predicted Primers

PCR Primer
(F):5'- AAGTATAGTTGCATCATCCCCAC -3'
(R):5'- AGTGGTTCTTAAAGGACTCTAAGG -3'

Sequencing Primer
(F):5'- TCTCCCTCTCAAATTATGTTACTGAG -3'
(R):5'- AAGGACTCTAAGGTTTACATGTTGG -3'

Posted On

2018-02-28