Incidental Mutation 'R6246:Muc16'
ID505788
Institutional Source Beutler Lab
Gene Symbol Muc16
Ensembl Gene ENSMUSG00000109564
Gene Namemucin 16
Synonyms1110008I14Rik, LOC385009
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.238) question?
Stock #R6246 (G1)
Quality Score117.008
Status Validated
Chromosome9
Chromosomal Location18495455-18674530 bp(-) (GRCm38)
Type of Mutationintron (175 bp from exon)
DNA Base Change (assembly) A to T at 18577067 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147104 (fasta)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122794
Predicted Effect probably null
Transcript: ENSMUST00000207857
Predicted Effect probably null
Transcript: ENSMUST00000208663
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 100% (78/78)
MGI Phenotype PHENOTYPE: Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik C A 17: 23,710,491 G315* probably null Het
2410089E03Rik T A 15: 8,210,014 L1233H probably damaging Het
Abca7 T A 10: 80,015,165 V2110E probably damaging Het
Acaca C A 11: 84,315,970 T1552K probably benign Het
AI314180 A G 4: 58,811,365 probably null Het
Aknad1 A G 3: 108,751,832 D54G probably damaging Het
Ano1 T C 7: 144,633,725 T435A possibly damaging Het
Azgp1 A G 5: 137,985,213 D50G possibly damaging Het
Bbx A G 16: 50,224,660 S513P probably benign Het
Ccdc114 A G 7: 45,936,364 I116V probably damaging Het
Ccdc129 A T 6: 55,967,672 K459N probably damaging Het
Ccdc85a C T 11: 28,576,897 S209N probably damaging Het
Cdca2 T A 14: 67,677,828 R661* probably null Het
Cdhr2 T C 13: 54,719,710 V451A probably damaging Het
Cenpt C T 8: 105,849,259 G152S possibly damaging Het
Chd9 A G 8: 90,932,417 T2A probably damaging Het
Chst14 G A 2: 118,927,001 C117Y probably damaging Het
Cic C T 7: 25,271,642 T266M probably damaging Het
Clec12a A T 6: 129,353,770 N105I possibly damaging Het
Cmah G A 13: 24,466,790 V525M probably damaging Het
Cpt1a T C 19: 3,376,550 L572P probably damaging Het
Crybg2 T C 4: 134,089,346 L1365P probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dlg1 G A 16: 31,665,650 S32N probably benign Het
Dnah14 T C 1: 181,680,888 I1877T probably benign Het
Duox1 G T 2: 122,327,174 G594C probably damaging Het
Eci2 T C 13: 34,990,198 N127D probably damaging Het
Fam57b T A 7: 126,827,496 F30L probably damaging Het
Fat4 T C 3: 38,891,721 S1588P probably damaging Het
Fer1l4 T A 2: 156,024,982 I1489F probably damaging Het
Flrt3 A G 2: 140,659,801 Y636H probably damaging Het
Frmd5 T A 2: 121,551,048 H62L possibly damaging Het
Gm6309 A T 5: 146,170,240 Y99N probably damaging Het
Gm8225 T C 17: 26,543,678 V281A probably benign Het
Grsf1 A G 5: 88,662,592 L353P possibly damaging Het
Gtf2a1l A G 17: 88,671,547 R58G probably benign Het
Guf1 G A 5: 69,558,555 G113R probably damaging Het
Hfe A T 13: 23,708,229 F51I probably damaging Het
Hibch T C 1: 52,904,642 S250P probably damaging Het
Il1rap T A 16: 26,714,881 M509K probably benign Het
Il4ra T C 7: 125,576,405 V595A probably benign Het
Ints11 A G 4: 155,888,089 T460A probably benign Het
Kdm5a G A 6: 120,431,910 G1518E probably damaging Het
Khsrp T C 17: 57,025,324 D289G possibly damaging Het
Kif14 C T 1: 136,476,424 Q29* probably null Het
Krt72 T C 15: 101,780,937 K320R probably damaging Het
Lcmt2 A G 2: 121,140,389 L71P probably damaging Het
Lmo7 A T 14: 101,918,700 D1037V probably damaging Het
Lpo T C 11: 87,822,232 T15A unknown Het
Mia3 G T 1: 183,345,277 T7N probably damaging Het
Mup9 T A 4: 60,419,810 Y29F probably damaging Het
Nisch T C 14: 31,172,559 D1105G probably damaging Het
Oip5 T C 2: 119,615,620 T136A probably benign Het
Olfr437 G A 6: 43,167,502 probably null Het
Osbpl10 C A 9: 115,226,774 N532K probably benign Het
P2ry12 C T 3: 59,217,529 V242I probably benign Het
Pdhx A T 2: 103,046,792 C26S probably damaging Het
Pgk2 A T 17: 40,207,424 I371K probably damaging Het
Phyhip T C 14: 70,467,055 V238A probably damaging Het
Pla2g4a G A 1: 149,872,587 T282I probably damaging Het
Pld5 A T 1: 175,963,909 C448* probably null Het
Plk1 T A 7: 122,169,436 I553N probably damaging Het
Ppp1r13l T A 7: 19,369,858 I88K probably benign Het
Rad54l2 A G 9: 106,700,493 probably null Het
Sept7 A G 9: 25,307,521 E428G probably benign Het
Serpina3j G A 12: 104,317,447 G268D probably damaging Het
Smc2 A T 4: 52,460,289 D555V probably damaging Het
Spag16 A T 1: 69,923,821 I376F probably benign Het
Spag6 G A 2: 18,699,095 probably null Het
Tecta T C 9: 42,377,908 I454V probably benign Het
Tm9sf1 C T 14: 55,636,370 R557H probably damaging Het
Traf5 C T 1: 192,070,553 E28K probably damaging Het
Trav23 G A 14: 53,977,428 E33K probably damaging Het
Trim32 T C 4: 65,614,564 S453P probably damaging Het
Tssk1 A G 16: 17,895,439 T363A probably benign Het
Txnrd3 A G 6: 89,651,541 N88S probably benign Het
Unc13b A G 4: 43,216,246 S182G probably benign Het
Vmn2r89 A T 14: 51,456,046 R284S probably damaging Het
Zbtb14 A G 17: 69,387,483 T59A possibly damaging Het
Zcchc2 T A 1: 106,030,066 S756T possibly damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Other mutations in Muc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Muc16 APN 9 18508507 missense possibly damaging 0.89
IGL01878:Muc16 APN 9 18495543 missense possibly damaging 0.90
IGL02394:Muc16 APN 9 18498700 missense probably damaging 0.99
IGL02553:Muc16 APN 9 18498553 critical splice donor site probably null
R0400:Muc16 UTSW 9 18510534 missense possibly damaging 0.74
R1620:Muc16 UTSW 9 18510477 missense possibly damaging 0.89
R1695:Muc16 UTSW 9 18497433 missense probably damaging 1.00
R3196:Muc16 UTSW 9 18497830 missense probably damaging 1.00
R5982:Muc16 UTSW 9 18647146 missense unknown
R5990:Muc16 UTSW 9 18659243 missense unknown
R6024:Muc16 UTSW 9 18646671 missense unknown
R6026:Muc16 UTSW 9 18659858 missense unknown
R6028:Muc16 UTSW 9 18657176 missense unknown
R6083:Muc16 UTSW 9 18657212 missense unknown
R6089:Muc16 UTSW 9 18643252 missense unknown
R6109:Muc16 UTSW 9 18655359 missense unknown
R6127:Muc16 UTSW 9 18657878 missense unknown
R6130:Muc16 UTSW 9 18590698 missense probably damaging 1.00
R6146:Muc16 UTSW 9 18497797 missense probably damaging 0.98
R6161:Muc16 UTSW 9 18647818 missense unknown
R6164:Muc16 UTSW 9 18558379 missense probably damaging 1.00
R6185:Muc16 UTSW 9 18654473 missense unknown
R6192:Muc16 UTSW 9 18658689 missense unknown
R6217:Muc16 UTSW 9 18655446 missense unknown
R6232:Muc16 UTSW 9 18656998 missense unknown
R6255:Muc16 UTSW 9 18655599 missense unknown
R6280:Muc16 UTSW 9 18579317 critical splice donor site probably null
R6286:Muc16 UTSW 9 18644389 missense unknown
R6287:Muc16 UTSW 9 18659034 missense unknown
R6307:Muc16 UTSW 9 18647588 missense unknown
R6310:Muc16 UTSW 9 18641950 missense probably benign 0.00
R6316:Muc16 UTSW 9 18641819 missense probably benign 0.01
R6335:Muc16 UTSW 9 18660708 missense unknown
R6345:Muc16 UTSW 9 18654926 missense unknown
R6349:Muc16 UTSW 9 18657329 missense unknown
R6366:Muc16 UTSW 9 18646044 missense unknown
R6393:Muc16 UTSW 9 18647399 nonsense probably null
R6440:Muc16 UTSW 9 18641359 missense probably benign 0.01
R6458:Muc16 UTSW 9 18641721 missense probably benign 0.01
R6460:Muc16 UTSW 9 18640516 missense probably benign 0.01
R6481:Muc16 UTSW 9 18550677 critical splice donor site probably null
R6539:Muc16 UTSW 9 18637325 missense probably benign 0.25
R6551:Muc16 UTSW 9 18562562 missense possibly damaging 0.95
R6596:Muc16 UTSW 9 18566715 missense probably benign 0.18
R6601:Muc16 UTSW 9 18637570 missense probably benign 0.10
R6602:Muc16 UTSW 9 18609476 intron probably null
R6615:Muc16 UTSW 9 18647188 missense unknown
R6625:Muc16 UTSW 9 18660278 missense unknown
R6668:Muc16 UTSW 9 18640385 missense probably benign 0.03
R6697:Muc16 UTSW 9 18641291 missense probably benign 0.01
R6710:Muc16 UTSW 9 18642070 missense possibly damaging 0.95
R6727:Muc16 UTSW 9 18566690 critical splice donor site probably null
R6789:Muc16 UTSW 9 18559986 missense probably benign 0.40
R6806:Muc16 UTSW 9 18537910 critical splice donor site probably null
R6874:Muc16 UTSW 9 18658769 nonsense probably null
R6894:Muc16 UTSW 9 18495576 missense possibly damaging 0.92
R6913:Muc16 UTSW 9 18642663 missense unknown
R6919:Muc16 UTSW 9 18660299 missense unknown
R6939:Muc16 UTSW 9 18638537 missense probably benign 0.04
R6953:Muc16 UTSW 9 18640529 missense probably benign 0.01
R6956:Muc16 UTSW 9 18645026 missense unknown
R6977:Muc16 UTSW 9 18645337 missense unknown
R6996:Muc16 UTSW 9 18645897 missense unknown
R7011:Muc16 UTSW 9 18637451 missense probably benign 0.26
R7011:Muc16 UTSW 9 18637543 missense probably benign 0.10
R7012:Muc16 UTSW 9 18495618 critical splice acceptor site probably null
R7014:Muc16 UTSW 9 18658236 missense unknown
R7021:Muc16 UTSW 9 18554919 missense unknown
R7021:Muc16 UTSW 9 18550831 splice site probably null
R7038:Muc16 UTSW 9 18620468 missense probably damaging 0.99
R7057:Muc16 UTSW 9 18646079 missense unknown
R7058:Muc16 UTSW 9 18639755 missense probably benign 0.10
R7066:Muc16 UTSW 9 18658021 missense unknown
R7067:Muc16 UTSW 9 18658251 missense unknown
R7070:Muc16 UTSW 9 18645923 nonsense probably null
R7074:Muc16 UTSW 9 18655650 missense unknown
R7085:Muc16 UTSW 9 18644849 missense unknown
R7088:Muc16 UTSW 9 18592680 missense probably damaging 0.99
R7107:Muc16 UTSW 9 18637298 missense probably benign 0.10
R7108:Muc16 UTSW 9 18655233 missense unknown
R7126:Muc16 UTSW 9 18641216 missense probably benign 0.01
R7128:Muc16 UTSW 9 18643004 missense unknown
R7145:Muc16 UTSW 9 18655580 missense unknown
R7179:Muc16 UTSW 9 18642008 missense probably benign 0.00
R7194:Muc16 UTSW 9 18674454 missense unknown
R7211:Muc16 UTSW 9 18498570 missense probably damaging 1.00
R7213:Muc16 UTSW 9 18641416 missense probably benign 0.01
R7217:Muc16 UTSW 9 18644076 nonsense probably null
R7221:Muc16 UTSW 9 18642199 missense probably benign 0.04
R7265:Muc16 UTSW 9 18656472 missense unknown
R7326:Muc16 UTSW 9 18585013 missense probably benign 0.03
R7359:Muc16 UTSW 9 18643020 missense unknown
R7387:Muc16 UTSW 9 18641720 missense probably benign 0.01
R7391:Muc16 UTSW 9 18639536 missense probably benign 0.04
R7398:Muc16 UTSW 9 18637742 missense possibly damaging 0.46
R7419:Muc16 UTSW 9 18641962 missense probably benign 0.01
R7431:Muc16 UTSW 9 18607993 missense
R7484:Muc16 UTSW 9 18646768 missense unknown
R7487:Muc16 UTSW 9 18584799 missense possibly damaging 0.93
R7497:Muc16 UTSW 9 18645089 missense unknown
R7515:Muc16 UTSW 9 18639662 missense probably benign 0.00
R7537:Muc16 UTSW 9 18638135 missense probably benign 0.06
R7538:Muc16 UTSW 9 18642131 missense probably benign 0.10
R7538:Muc16 UTSW 9 18655451 missense unknown
R7543:Muc16 UTSW 9 18644732 missense unknown
R7566:Muc16 UTSW 9 18638629 missense probably benign 0.00
R7581:Muc16 UTSW 9 18645614 missense unknown
R7594:Muc16 UTSW 9 18645062 missense unknown
R7629:Muc16 UTSW 9 18566785 missense possibly damaging 0.86
R7664:Muc16 UTSW 9 18607722 missense probably benign 0.08
R7666:Muc16 UTSW 9 18558427 missense probably damaging 1.00
R7703:Muc16 UTSW 9 18605282 missense
R7727:Muc16 UTSW 9 18660242 missense unknown
R7743:Muc16 UTSW 9 18657477 missense unknown
R7744:Muc16 UTSW 9 18585096 critical splice acceptor site probably null
R7761:Muc16 UTSW 9 18580574 missense probably damaging 1.00
R7769:Muc16 UTSW 9 18660507 missense unknown
R7805:Muc16 UTSW 9 18638493 missense possibly damaging 0.94
R7827:Muc16 UTSW 9 18595223 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TTAGTTGGGATAGCAACCGAG -3'
(R):5'- GTGAGATTTCTGCCCACCTC -3'

Sequencing Primer
(F):5'- TGGGCCAACCATCAGTGACTAG -3'
(R):5'- GAGATTTCTGCCCACCTCTCTTAC -3'
Posted On2018-02-28