Incidental Mutation 'R6246:Krt72'
ID505810
Institutional Source Beutler Lab
Gene Symbol Krt72
Ensembl Gene ENSMUSG00000056605
Gene Namekeratin 72
SynonymsKrt72-ps, K6irs2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R6246 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location101776172-101786460 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101780937 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 320 (K320R)
Ref Sequence ENSEMBL: ENSMUSP00000065922 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071104]
Predicted Effect probably damaging
Transcript: ENSMUST00000071104
AA Change: K320R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065922
Gene: ENSMUSG00000056605
AA Change: K320R

DomainStartEndE-ValueType
Pfam:Keratin_2_head 59 130 3.1e-17 PFAM
Filament 133 446 6.9e-157 SMART
low complexity region 454 462 N/A INTRINSIC
low complexity region 465 481 N/A INTRINSIC
low complexity region 507 519 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127671
Meta Mutation Damage Score 0.2069 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells. The type II keratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. This gene encodes a type II keratin that is specifically expressed in the inner root sheath of hair follicles. The type II keratins are clustered in a region of chromosome 12q12-q13. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik C A 17: 23,710,491 G315* probably null Het
2410089E03Rik T A 15: 8,210,014 L1233H probably damaging Het
Abca7 T A 10: 80,015,165 V2110E probably damaging Het
Acaca C A 11: 84,315,970 T1552K probably benign Het
AI314180 A G 4: 58,811,365 probably null Het
Aknad1 A G 3: 108,751,832 D54G probably damaging Het
Ano1 T C 7: 144,633,725 T435A possibly damaging Het
Azgp1 A G 5: 137,985,213 D50G possibly damaging Het
Bbx A G 16: 50,224,660 S513P probably benign Het
Ccdc114 A G 7: 45,936,364 I116V probably damaging Het
Ccdc129 A T 6: 55,967,672 K459N probably damaging Het
Ccdc85a C T 11: 28,576,897 S209N probably damaging Het
Cdca2 T A 14: 67,677,828 R661* probably null Het
Cdhr2 T C 13: 54,719,710 V451A probably damaging Het
Cenpt C T 8: 105,849,259 G152S possibly damaging Het
Chd9 A G 8: 90,932,417 T2A probably damaging Het
Chst14 G A 2: 118,927,001 C117Y probably damaging Het
Cic C T 7: 25,271,642 T266M probably damaging Het
Clec12a A T 6: 129,353,770 N105I possibly damaging Het
Cmah G A 13: 24,466,790 V525M probably damaging Het
Cpt1a T C 19: 3,376,550 L572P probably damaging Het
Crybg2 T C 4: 134,089,346 L1365P probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dlg1 G A 16: 31,665,650 S32N probably benign Het
Dnah14 T C 1: 181,680,888 I1877T probably benign Het
Duox1 G T 2: 122,327,174 G594C probably damaging Het
Eci2 T C 13: 34,990,198 N127D probably damaging Het
Fam57b T A 7: 126,827,496 F30L probably damaging Het
Fat4 T C 3: 38,891,721 S1588P probably damaging Het
Fer1l4 T A 2: 156,024,982 I1489F probably damaging Het
Flrt3 A G 2: 140,659,801 Y636H probably damaging Het
Frmd5 T A 2: 121,551,048 H62L possibly damaging Het
Gm6309 A T 5: 146,170,240 Y99N probably damaging Het
Gm8225 T C 17: 26,543,678 V281A probably benign Het
Grsf1 A G 5: 88,662,592 L353P possibly damaging Het
Gtf2a1l A G 17: 88,671,547 R58G probably benign Het
Guf1 G A 5: 69,558,555 G113R probably damaging Het
Hfe A T 13: 23,708,229 F51I probably damaging Het
Hibch T C 1: 52,904,642 S250P probably damaging Het
Il1rap T A 16: 26,714,881 M509K probably benign Het
Il4ra T C 7: 125,576,405 V595A probably benign Het
Ints11 A G 4: 155,888,089 T460A probably benign Het
Kdm5a G A 6: 120,431,910 G1518E probably damaging Het
Khsrp T C 17: 57,025,324 D289G possibly damaging Het
Kif14 C T 1: 136,476,424 Q29* probably null Het
Lcmt2 A G 2: 121,140,389 L71P probably damaging Het
Lmo7 A T 14: 101,918,700 D1037V probably damaging Het
Lpo T C 11: 87,822,232 T15A unknown Het
Mia3 G T 1: 183,345,277 T7N probably damaging Het
Muc16 A T 9: 18,577,067 probably null Het
Mup9 T A 4: 60,419,810 Y29F probably damaging Het
Nisch T C 14: 31,172,559 D1105G probably damaging Het
Oip5 T C 2: 119,615,620 T136A probably benign Het
Olfr437 G A 6: 43,167,502 probably null Het
Osbpl10 C A 9: 115,226,774 N532K probably benign Het
P2ry12 C T 3: 59,217,529 V242I probably benign Het
Pdhx A T 2: 103,046,792 C26S probably damaging Het
Pgk2 A T 17: 40,207,424 I371K probably damaging Het
Phyhip T C 14: 70,467,055 V238A probably damaging Het
Pla2g4a G A 1: 149,872,587 T282I probably damaging Het
Pld5 A T 1: 175,963,909 C448* probably null Het
Plk1 T A 7: 122,169,436 I553N probably damaging Het
Ppp1r13l T A 7: 19,369,858 I88K probably benign Het
Rad54l2 A G 9: 106,700,493 probably null Het
Sept7 A G 9: 25,307,521 E428G probably benign Het
Serpina3j G A 12: 104,317,447 G268D probably damaging Het
Smc2 A T 4: 52,460,289 D555V probably damaging Het
Spag16 A T 1: 69,923,821 I376F probably benign Het
Spag6 G A 2: 18,699,095 probably null Het
Tecta T C 9: 42,377,908 I454V probably benign Het
Tm9sf1 C T 14: 55,636,370 R557H probably damaging Het
Traf5 C T 1: 192,070,553 E28K probably damaging Het
Trav23 G A 14: 53,977,428 E33K probably damaging Het
Trim32 T C 4: 65,614,564 S453P probably damaging Het
Tssk1 A G 16: 17,895,439 T363A probably benign Het
Txnrd3 A G 6: 89,651,541 N88S probably benign Het
Unc13b A G 4: 43,216,246 S182G probably benign Het
Vmn2r89 A T 14: 51,456,046 R284S probably damaging Het
Zbtb14 A G 17: 69,387,483 T59A possibly damaging Het
Zcchc2 T A 1: 106,030,066 S756T possibly damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Other mutations in Krt72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Krt72 APN 15 101784999 missense probably damaging 0.99
IGL00568:Krt72 APN 15 101781015 missense probably damaging 1.00
IGL00966:Krt72 APN 15 101780961 missense probably damaging 1.00
IGL01997:Krt72 APN 15 101784880 missense probably damaging 0.99
IGL02858:Krt72 APN 15 101782121 missense probably damaging 1.00
IGL03260:Krt72 APN 15 101778273 missense probably damaging 1.00
R0062:Krt72 UTSW 15 101786008 missense probably damaging 0.98
R0062:Krt72 UTSW 15 101786008 missense probably damaging 0.98
R0601:Krt72 UTSW 15 101786056 missense probably damaging 1.00
R0669:Krt72 UTSW 15 101778305 missense probably damaging 0.99
R1396:Krt72 UTSW 15 101786005 critical splice donor site probably null
R1501:Krt72 UTSW 15 101778334 missense probably damaging 1.00
R1598:Krt72 UTSW 15 101780253 missense probably benign 0.00
R1779:Krt72 UTSW 15 101780929 missense probably benign
R1796:Krt72 UTSW 15 101781552 splice site probably null
R4259:Krt72 UTSW 15 101778257 missense probably damaging 0.99
R4835:Krt72 UTSW 15 101781073 splice site probably null
R4871:Krt72 UTSW 15 101786034 missense probably damaging 1.00
R6513:Krt72 UTSW 15 101776752 critical splice acceptor site probably null
R6520:Krt72 UTSW 15 101781046 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATACATTCAGGCCCACGTGTG -3'
(R):5'- GCTTGGGATGAAGTTCACCC -3'

Sequencing Primer
(F):5'- GCCCACGTGTGCACATAC -3'
(R):5'- AAGTAGTGTCCTCATGGCAC -3'
Posted On2018-02-28