Incidental Mutation 'R6249:Pisd'
ID505836
Institutional Source Beutler Lab
Gene Symbol Pisd
Ensembl Gene ENSMUSG00000023452
Gene Namephosphatidylserine decarboxylase
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6249 (G1)
Quality Score132.008
Status Not validated
Chromosome5
Chromosomal Location32736301-32785646 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 32738844 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 379 (T379N)
Ref Sequence ENSEMBL: ENSMUSP00000124923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061895] [ENSMUST00000071829] [ENSMUST00000120591] [ENSMUST00000135248] [ENSMUST00000142957] [ENSMUST00000144673] [ENSMUST00000197787] [ENSMUST00000200390] [ENSMUST00000202283]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061895
AA Change: T209N

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000051438
Gene: ENSMUSG00000023452
AA Change: T209N

DomainStartEndE-ValueType
Pfam:PS_Dcarbxylase 162 405 1.1e-71 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000071829
AA Change: T178N

PolyPhen 2 Score 0.662 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000071732
Gene: ENSMUSG00000023452
AA Change: T178N

DomainStartEndE-ValueType
Pfam:PS_Dcarbxylase 131 260 3.9e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119864
Predicted Effect possibly damaging
Transcript: ENSMUST00000120591
AA Change: T178N

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112573
Gene: ENSMUSG00000023452
AA Change: T178N

DomainStartEndE-ValueType
Pfam:PS_Dcarbxylase 131 374 1.1e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135248
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138360
Predicted Effect unknown
Transcript: ENSMUST00000142779
AA Change: T199N
SMART Domains Protein: ENSMUSP00000122705
Gene: ENSMUSG00000023452
AA Change: T199N

DomainStartEndE-ValueType
Pfam:PS_Dcarbxylase 153 270 1.7e-33 PFAM
Pfam:PS_Dcarbxylase 268 358 2.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142957
Predicted Effect probably damaging
Transcript: ENSMUST00000144673
AA Change: T379N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124923
Gene: ENSMUSG00000093574
AA Change: T379N

DomainStartEndE-ValueType
Pfam:Tantalus 158 193 1.2e-15 PFAM
Pfam:PS_Dcarbxylase 332 575 2.1e-71 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196545
Predicted Effect probably benign
Transcript: ENSMUST00000197787
Predicted Effect probably benign
Transcript: ENSMUST00000200390
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201314
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201980
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202224
Predicted Effect probably benign
Transcript: ENSMUST00000202283
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202641
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the conversion of phosphatidylserine to phosphatidylethanolamine in the inner mitochondrial membrane. The encoded protein is active in phospholipid metabolism and interorganelle trafficking of phosphatidylserine. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for a null mutation in this gene display embryogenesis defects such as abnormal trophoblast development, abnormal extraembronic tissue morphology and abnormal mitochondrial morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004F10Rik A T 7: 116,103,270 S90C probably damaging Het
Abca9 T C 11: 110,145,627 D552G probably benign Het
Adgrb3 A G 1: 25,432,558 L502P probably damaging Het
Agmo T C 12: 37,243,838 probably null Het
Ank3 A G 10: 69,823,076 probably null Het
Apol11b G T 15: 77,635,337 T181K probably benign Het
Arap2 G T 5: 62,646,193 H1244N probably damaging Het
Arid1b A T 17: 5,279,361 M838L possibly damaging Het
Aste1 G A 9: 105,396,617 V19I probably benign Het
B3gnt3 A T 8: 71,692,662 M354K probably damaging Het
Calcr A T 6: 3,692,711 M381K possibly damaging Het
Ccdc63 A C 5: 122,124,999 L160W probably benign Het
Cerkl A G 2: 79,368,778 L156P probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Ddb1 C A 19: 10,605,720 Y5* probably null Het
Fam205a1 A T 4: 42,850,528 W543R probably benign Het
Fignl2 T C 15: 101,054,179 E74G possibly damaging Het
Glb1l2 C T 9: 26,765,554 probably benign Het
Gm10031 A G 1: 156,525,230 M334V probably benign Het
Gm16503 A G 4: 147,541,051 M1V probably null Het
Gm2696 A C 10: 77,794,812 probably benign Het
Gm45844 A G 7: 7,240,093 S20P probably benign Het
Gm7579 C T 7: 142,212,006 P50S unknown Het
Idh1 A G 1: 65,166,219 S196P probably damaging Het
Il1rap T C 16: 26,692,848 V214A possibly damaging Het
Kctd17 C G 15: 78,430,039 probably null Het
Lama1 G T 17: 67,798,604 V2036L probably benign Het
Lars G T 18: 42,257,206 probably null Het
Mdn1 T A 4: 32,708,484 V1670E possibly damaging Het
Mtmr7 A T 8: 40,581,482 I266N probably damaging Het
Ncapd3 GGCTGCTGCTGCTGCTGCTGCTG GGCTGCTGCTGCTGCTGCTG 9: 27,088,053 probably benign Het
Nckap5 T C 1: 126,024,930 E1295G probably benign Het
Nrxn3 T A 12: 89,254,678 V409D probably damaging Het
Olfr1341 A G 4: 118,709,713 Y102C probably damaging Het
Olfr169 T A 16: 19,565,975 N303Y probably damaging Het
Olfr190 T C 16: 59,074,432 Y216C probably damaging Het
Olfr448 G T 6: 42,897,304 L284F probably damaging Het
Olfr635 A T 7: 103,979,611 S140C possibly damaging Het
Olfr907 T G 9: 38,499,584 I305R unknown Het
Pcdha4 T A 18: 36,953,676 V304E probably damaging Het
Pde6c T C 19: 38,158,560 probably null Het
Pebp4 A T 14: 70,059,650 T213S possibly damaging Het
Phf2 C A 13: 48,805,872 R886L unknown Het
Pik3ca A T 3: 32,461,563 H795L probably damaging Het
Pld2 T C 11: 70,555,370 L732P probably damaging Het
Pskh1 A G 8: 105,912,985 D99G possibly damaging Het
Rest A G 5: 77,281,224 T497A probably benign Het
Rps24 C T 14: 24,493,462 T108M possibly damaging Het
Rtel1 C T 2: 181,351,682 R566C probably damaging Het
Scyl2 A G 10: 89,657,857 S350P possibly damaging Het
Slc38a7 G T 8: 95,837,674 probably null Het
Sox5 A G 6: 143,833,283 I674T probably benign Het
Surf4 C A 2: 26,926,887 E39D probably damaging Het
Tas2r144 T A 6: 42,215,357 Y10* probably null Het
Thbs4 C T 13: 92,774,707 G323R probably damaging Het
Top2b A G 14: 16,399,006 Y542C probably damaging Het
Trim61 A G 8: 65,014,456 V51A probably benign Het
Tyrp1 T A 4: 80,850,772 I501N possibly damaging Het
U2surp C T 9: 95,500,816 D32N probably benign Het
Ush1c T C 7: 46,214,959 Y411C probably damaging Het
Vwa7 G A 17: 35,023,389 V490I probably benign Het
Xylt1 G T 7: 117,667,305 A849S probably benign Het
Ythdc1 T A 5: 86,831,956 N599K possibly damaging Het
Zbtb38 T A 9: 96,685,992 Y1013F probably damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Zswim9 T C 7: 13,260,977 S418G probably damaging Het
Other mutations in Pisd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Pisd APN 5 32738412 missense probably benign 0.02
IGL00540:Pisd APN 5 32738412 missense probably benign 0.02
IGL00577:Pisd APN 5 32738412 missense probably benign 0.02
IGL00580:Pisd APN 5 32738412 missense probably benign 0.02
IGL00590:Pisd APN 5 32738412 missense probably benign 0.02
IGL00990:Pisd APN 5 32739358 missense probably benign 0.24
IGL01899:Pisd APN 5 32739132 splice site probably null
IGL01908:Pisd APN 5 32739132 splice site probably null
IGL01928:Pisd APN 5 32739132 splice site probably null
IGL01931:Pisd APN 5 32739132 splice site probably null
IGL01935:Pisd APN 5 32739132 splice site probably null
IGL01948:Pisd APN 5 32739132 splice site probably null
IGL01952:Pisd APN 5 32739132 splice site probably null
IGL02195:Pisd APN 5 32737315 missense probably damaging 1.00
shandong UTSW 5 32764796 missense possibly damaging 0.94
R0674:Pisd UTSW 5 32774437 missense probably benign 0.00
R0840:Pisd UTSW 5 32737312 missense probably damaging 1.00
R1976:Pisd UTSW 5 32738865 missense probably damaging 1.00
R1986:Pisd UTSW 5 32737328 missense probably damaging 1.00
R2044:Pisd UTSW 5 32764796 missense possibly damaging 0.94
R5705:Pisd UTSW 5 32737363 missense probably benign 0.14
R5756:Pisd UTSW 5 32738498 missense probably damaging 1.00
R6389:Pisd UTSW 5 32764847 missense probably damaging 1.00
R6913:Pisd UTSW 5 32737429 missense probably damaging 1.00
R7143:Pisd UTSW 5 32738502 missense possibly damaging 0.73
R7571:Pisd UTSW 5 32737337 missense probably damaging 1.00
R7626:Pisd UTSW 5 32740688 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TACATGGCCTGCATGTAGCC -3'
(R):5'- TGTCTGCCTTTAAGCCAGG -3'

Sequencing Primer
(F):5'- CATGGCCTGCATGTAGCCAATAATG -3'
(R):5'- TGACCTGGACTGGAGCTC -3'
Posted On2018-02-28