Incidental Mutation 'R6249:Zbtb38'
ID505862
Institutional Source Beutler Lab
Gene Symbol Zbtb38
Ensembl Gene ENSMUSG00000040433
Gene Namezinc finger and BTB domain containing 38
SynonymsCIBZ, A930014K01Rik, Zenon homolog
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.359) question?
Stock #R6249 (G1)
Quality Score187.009
Status Not validated
Chromosome9
Chromosomal Location96682770-96752831 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 96685992 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 1013 (Y1013F)
Ref Sequence ENSEMBL: ENSMUSP00000121753 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093798] [ENSMUST00000126066] [ENSMUST00000128269] [ENSMUST00000140121] [ENSMUST00000152594]
Predicted Effect probably damaging
Transcript: ENSMUST00000093798
AA Change: Y1013F

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000091315
Gene: ENSMUSG00000040433
AA Change: Y1013F

DomainStartEndE-ValueType
BTB 33 131 5.68e-20 SMART
low complexity region 140 151 N/A INTRINSIC
ZnF_C2H2 340 362 7.67e-2 SMART
ZnF_C2H2 369 396 7.29e0 SMART
low complexity region 435 446 N/A INTRINSIC
ZnF_C2H2 458 480 2.2e-2 SMART
ZnF_C2H2 486 508 1.05e1 SMART
ZnF_C2H2 514 537 8.09e-1 SMART
low complexity region 911 935 N/A INTRINSIC
low complexity region 994 1002 N/A INTRINSIC
ZnF_C2H2 1013 1035 3.63e-3 SMART
ZnF_C2H2 1041 1063 9.73e-4 SMART
ZnF_C2H2 1069 1091 1.45e-2 SMART
ZnF_C2H2 1097 1119 1.02e1 SMART
ZnF_C2H2 1128 1150 1.67e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126066
SMART Domains Protein: ENSMUSP00000114300
Gene: ENSMUSG00000040433

DomainStartEndE-ValueType
BTB 33 131 5.68e-20 SMART
low complexity region 140 151 N/A INTRINSIC
ZnF_C2H2 340 362 7.67e-2 SMART
ZnF_C2H2 369 396 7.29e0 SMART
low complexity region 435 446 N/A INTRINSIC
ZnF_C2H2 458 480 2.2e-2 SMART
ZnF_C2H2 486 508 1.05e1 SMART
ZnF_C2H2 514 537 8.09e-1 SMART
low complexity region 911 926 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128269
SMART Domains Protein: ENSMUSP00000121871
Gene: ENSMUSG00000040433

DomainStartEndE-ValueType
BTB 33 131 5.68e-20 SMART
low complexity region 140 151 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140121
SMART Domains Protein: ENSMUSP00000120040
Gene: ENSMUSG00000040433

DomainStartEndE-ValueType
BTB 33 131 5.68e-20 SMART
low complexity region 140 151 N/A INTRINSIC
ZnF_C2H2 340 362 7.67e-2 SMART
ZnF_C2H2 369 396 7.29e0 SMART
low complexity region 435 446 N/A INTRINSIC
ZnF_C2H2 458 480 2.2e-2 SMART
ZnF_C2H2 486 508 1.05e1 SMART
ZnF_C2H2 514 537 8.09e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000152594
AA Change: Y1013F

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000121753
Gene: ENSMUSG00000040433
AA Change: Y1013F

DomainStartEndE-ValueType
BTB 33 131 5.68e-20 SMART
low complexity region 140 151 N/A INTRINSIC
ZnF_C2H2 340 362 7.67e-2 SMART
ZnF_C2H2 369 396 7.29e0 SMART
low complexity region 435 446 N/A INTRINSIC
ZnF_C2H2 458 480 2.2e-2 SMART
ZnF_C2H2 486 508 1.05e1 SMART
ZnF_C2H2 514 537 8.09e-1 SMART
low complexity region 911 935 N/A INTRINSIC
low complexity region 994 1002 N/A INTRINSIC
ZnF_C2H2 1013 1035 3.63e-3 SMART
ZnF_C2H2 1041 1063 9.73e-4 SMART
ZnF_C2H2 1069 1091 1.45e-2 SMART
ZnF_C2H2 1097 1119 1.02e1 SMART
ZnF_C2H2 1128 1150 1.67e-2 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcriptional activator that binds methylated DNA. The encoded protein can form homodimers or heterodimers through the zinc finger domains. In mouse, inhibition of this protein has been associated with apoptosis in some cell types. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004F10Rik A T 7: 116,103,270 S90C probably damaging Het
Abca9 T C 11: 110,145,627 D552G probably benign Het
Adgrb3 A G 1: 25,432,558 L502P probably damaging Het
Agmo T C 12: 37,243,838 probably null Het
Ank3 A G 10: 69,823,076 probably null Het
Apol11b G T 15: 77,635,337 T181K probably benign Het
Arap2 G T 5: 62,646,193 H1244N probably damaging Het
Arid1b A T 17: 5,279,361 M838L possibly damaging Het
Aste1 G A 9: 105,396,617 V19I probably benign Het
B3gnt3 A T 8: 71,692,662 M354K probably damaging Het
Calcr A T 6: 3,692,711 M381K possibly damaging Het
Ccdc63 A C 5: 122,124,999 L160W probably benign Het
Cerkl A G 2: 79,368,778 L156P probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Ddb1 C A 19: 10,605,720 Y5* probably null Het
Fam205a1 A T 4: 42,850,528 W543R probably benign Het
Fignl2 T C 15: 101,054,179 E74G possibly damaging Het
Glb1l2 C T 9: 26,765,554 probably benign Het
Gm10031 A G 1: 156,525,230 M334V probably benign Het
Gm16503 A G 4: 147,541,051 M1V probably null Het
Gm2696 A C 10: 77,794,812 probably benign Het
Gm45844 A G 7: 7,240,093 S20P probably benign Het
Gm7579 C T 7: 142,212,006 P50S unknown Het
Idh1 A G 1: 65,166,219 S196P probably damaging Het
Il1rap T C 16: 26,692,848 V214A possibly damaging Het
Kctd17 C G 15: 78,430,039 probably null Het
Lama1 G T 17: 67,798,604 V2036L probably benign Het
Lars G T 18: 42,257,206 probably null Het
Mdn1 T A 4: 32,708,484 V1670E possibly damaging Het
Mtmr7 A T 8: 40,581,482 I266N probably damaging Het
Ncapd3 GGCTGCTGCTGCTGCTGCTGCTG GGCTGCTGCTGCTGCTGCTG 9: 27,088,053 probably benign Het
Nckap5 T C 1: 126,024,930 E1295G probably benign Het
Nrxn3 T A 12: 89,254,678 V409D probably damaging Het
Olfr1341 A G 4: 118,709,713 Y102C probably damaging Het
Olfr169 T A 16: 19,565,975 N303Y probably damaging Het
Olfr190 T C 16: 59,074,432 Y216C probably damaging Het
Olfr448 G T 6: 42,897,304 L284F probably damaging Het
Olfr635 A T 7: 103,979,611 S140C possibly damaging Het
Olfr907 T G 9: 38,499,584 I305R unknown Het
Pcdha4 T A 18: 36,953,676 V304E probably damaging Het
Pde6c T C 19: 38,158,560 probably null Het
Pebp4 A T 14: 70,059,650 T213S possibly damaging Het
Phf2 C A 13: 48,805,872 R886L unknown Het
Pik3ca A T 3: 32,461,563 H795L probably damaging Het
Pisd G T 5: 32,738,844 T379N probably damaging Het
Pld2 T C 11: 70,555,370 L732P probably damaging Het
Pskh1 A G 8: 105,912,985 D99G possibly damaging Het
Rest A G 5: 77,281,224 T497A probably benign Het
Rps24 C T 14: 24,493,462 T108M possibly damaging Het
Rtel1 C T 2: 181,351,682 R566C probably damaging Het
Scyl2 A G 10: 89,657,857 S350P possibly damaging Het
Slc38a7 G T 8: 95,837,674 probably null Het
Sox5 A G 6: 143,833,283 I674T probably benign Het
Surf4 C A 2: 26,926,887 E39D probably damaging Het
Tas2r144 T A 6: 42,215,357 Y10* probably null Het
Thbs4 C T 13: 92,774,707 G323R probably damaging Het
Top2b A G 14: 16,399,006 Y542C probably damaging Het
Trim61 A G 8: 65,014,456 V51A probably benign Het
Tyrp1 T A 4: 80,850,772 I501N possibly damaging Het
U2surp C T 9: 95,500,816 D32N probably benign Het
Ush1c T C 7: 46,214,959 Y411C probably damaging Het
Vwa7 G A 17: 35,023,389 V490I probably benign Het
Xylt1 G T 7: 117,667,305 A849S probably benign Het
Ythdc1 T A 5: 86,831,956 N599K possibly damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Zswim9 T C 7: 13,260,977 S418G probably damaging Het
Other mutations in Zbtb38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Zbtb38 APN 9 96687494 missense probably damaging 1.00
IGL01895:Zbtb38 APN 9 96688408 missense probably benign 0.00
IGL02513:Zbtb38 APN 9 96687073 missense probably damaging 1.00
IGL02649:Zbtb38 APN 9 96686619 missense probably damaging 0.96
IGL02938:Zbtb38 APN 9 96687174 missense probably benign 0.11
PIT4131001:Zbtb38 UTSW 9 96686316 missense probably damaging 1.00
R0048:Zbtb38 UTSW 9 96687676 missense probably damaging 1.00
R0152:Zbtb38 UTSW 9 96686280 missense probably damaging 1.00
R0158:Zbtb38 UTSW 9 96686940 missense possibly damaging 0.46
R0519:Zbtb38 UTSW 9 96685773 missense probably damaging 1.00
R0594:Zbtb38 UTSW 9 96685954 missense probably damaging 1.00
R1556:Zbtb38 UTSW 9 96686991 missense probably benign 0.26
R1698:Zbtb38 UTSW 9 96685462 missense probably benign
R1772:Zbtb38 UTSW 9 96688041 missense probably damaging 1.00
R1799:Zbtb38 UTSW 9 96688881 missense probably damaging 1.00
R1837:Zbtb38 UTSW 9 96686995 missense probably benign
R2446:Zbtb38 UTSW 9 96687646 missense probably damaging 1.00
R3153:Zbtb38 UTSW 9 96688249 missense probably benign 0.34
R3950:Zbtb38 UTSW 9 96687546 missense probably damaging 1.00
R4240:Zbtb38 UTSW 9 96686102 small deletion probably benign
R4630:Zbtb38 UTSW 9 96688851 missense probably damaging 1.00
R4666:Zbtb38 UTSW 9 96688383 missense probably damaging 1.00
R4732:Zbtb38 UTSW 9 96687684 missense probably damaging 1.00
R4733:Zbtb38 UTSW 9 96687684 missense probably damaging 1.00
R4824:Zbtb38 UTSW 9 96688201 missense probably benign 0.06
R5006:Zbtb38 UTSW 9 96685651 missense probably damaging 1.00
R5109:Zbtb38 UTSW 9 96687009 missense probably damaging 0.99
R5251:Zbtb38 UTSW 9 96687108 missense probably benign 0.43
R5396:Zbtb38 UTSW 9 96687643 missense probably damaging 1.00
R5659:Zbtb38 UTSW 9 96687420 missense probably damaging 1.00
R6294:Zbtb38 UTSW 9 96687229 missense probably benign 0.05
R6615:Zbtb38 UTSW 9 96686654 nonsense probably null
R6625:Zbtb38 UTSW 9 96687313 missense probably damaging 1.00
R6885:Zbtb38 UTSW 9 96686464 missense probably damaging 1.00
R7304:Zbtb38 UTSW 9 96687427 missense probably damaging 0.96
R7675:Zbtb38 UTSW 9 96685541 missense probably benign 0.00
R7823:Zbtb38 UTSW 9 96685976 nonsense probably null
R7900:Zbtb38 UTSW 9 96688936 missense probably damaging 1.00
R7983:Zbtb38 UTSW 9 96688936 missense probably damaging 1.00
X0066:Zbtb38 UTSW 9 96687612 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCTCTCGTGGATCTTGAGCG -3'
(R):5'- TCGTGCAGAGGTGAAACTG -3'

Sequencing Primer
(F):5'- GCCTTGTTACAATACTGACAGATG -3'
(R):5'- GGTGAAACTGCCCCCAGATAAG -3'
Posted On2018-02-28