Incidental Mutation 'R6249:Agmo'
ID505869
Institutional Source Beutler Lab
Gene Symbol Agmo
Ensembl Gene ENSMUSG00000050103
Gene Namealkylglycerol monooxygenase
SynonymsA530016O06Rik, Tmem195
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R6249 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location37241641-37582202 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 37243838 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049874] [ENSMUST00000159998] [ENSMUST00000160390] [ENSMUST00000160768]
Predicted Effect probably null
Transcript: ENSMUST00000049874
SMART Domains Protein: ENSMUSP00000051441
Gene: ENSMUSG00000050103

DomainStartEndE-ValueType
transmembrane domain 44 61 N/A INTRINSIC
Pfam:FA_hydroxylase 117 249 2.5e-29 PFAM
transmembrane domain 364 383 N/A INTRINSIC
transmembrane domain 411 433 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159998
SMART Domains Protein: ENSMUSP00000123801
Gene: ENSMUSG00000050103

DomainStartEndE-ValueType
transmembrane domain 44 61 N/A INTRINSIC
Pfam:FA_hydroxylase 117 226 7e-21 PFAM
transmembrane domain 364 383 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160158
Predicted Effect probably null
Transcript: ENSMUST00000160390
SMART Domains Protein: ENSMUSP00000125639
Gene: ENSMUSG00000050103

DomainStartEndE-ValueType
transmembrane domain 44 61 N/A INTRINSIC
Pfam:FA_hydroxylase 117 226 7.1e-21 PFAM
transmembrane domain 364 383 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000160768
SMART Domains Protein: ENSMUSP00000124044
Gene: ENSMUSG00000050103

DomainStartEndE-ValueType
transmembrane domain 43 61 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a tetrahydrobiopterin- and iron-dependent enzyme that cleaves the ether bond of alkylglycerols. Sequence comparisons distinguish this protein as forming a third, distinct class of tetrahydrobiopterin-dependent enzymes. Variations in this gene have been associated with decreased glucose-stimulated insulin response, type 2 diabetes, and susceptibility to intracranial aneurysms. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004F10Rik A T 7: 116,103,270 S90C probably damaging Het
Abca9 T C 11: 110,145,627 D552G probably benign Het
Adgrb3 A G 1: 25,432,558 L502P probably damaging Het
Ank3 A G 10: 69,823,076 probably null Het
Apol11b G T 15: 77,635,337 T181K probably benign Het
Arap2 G T 5: 62,646,193 H1244N probably damaging Het
Arid1b A T 17: 5,279,361 M838L possibly damaging Het
Aste1 G A 9: 105,396,617 V19I probably benign Het
B3gnt3 A T 8: 71,692,662 M354K probably damaging Het
Calcr A T 6: 3,692,711 M381K possibly damaging Het
Ccdc63 A C 5: 122,124,999 L160W probably benign Het
Cerkl A G 2: 79,368,778 L156P probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Ddb1 C A 19: 10,605,720 Y5* probably null Het
Fam205a1 A T 4: 42,850,528 W543R probably benign Het
Fignl2 T C 15: 101,054,179 E74G possibly damaging Het
Glb1l2 C T 9: 26,765,554 probably benign Het
Gm10031 A G 1: 156,525,230 M334V probably benign Het
Gm16503 A G 4: 147,541,051 M1V probably null Het
Gm2696 A C 10: 77,794,812 probably benign Het
Gm45844 A G 7: 7,240,093 S20P probably benign Het
Gm7579 C T 7: 142,212,006 P50S unknown Het
Idh1 A G 1: 65,166,219 S196P probably damaging Het
Il1rap T C 16: 26,692,848 V214A possibly damaging Het
Kctd17 C G 15: 78,430,039 probably null Het
Lama1 G T 17: 67,798,604 V2036L probably benign Het
Lars G T 18: 42,257,206 probably null Het
Mdn1 T A 4: 32,708,484 V1670E possibly damaging Het
Mtmr7 A T 8: 40,581,482 I266N probably damaging Het
Ncapd3 GGCTGCTGCTGCTGCTGCTGCTG GGCTGCTGCTGCTGCTGCTG 9: 27,088,053 probably benign Het
Nckap5 T C 1: 126,024,930 E1295G probably benign Het
Nrxn3 T A 12: 89,254,678 V409D probably damaging Het
Olfr1341 A G 4: 118,709,713 Y102C probably damaging Het
Olfr169 T A 16: 19,565,975 N303Y probably damaging Het
Olfr190 T C 16: 59,074,432 Y216C probably damaging Het
Olfr448 G T 6: 42,897,304 L284F probably damaging Het
Olfr635 A T 7: 103,979,611 S140C possibly damaging Het
Olfr907 T G 9: 38,499,584 I305R unknown Het
Pcdha4 T A 18: 36,953,676 V304E probably damaging Het
Pde6c T C 19: 38,158,560 probably null Het
Pebp4 A T 14: 70,059,650 T213S possibly damaging Het
Phf2 C A 13: 48,805,872 R886L unknown Het
Pik3ca A T 3: 32,461,563 H795L probably damaging Het
Pisd G T 5: 32,738,844 T379N probably damaging Het
Pld2 T C 11: 70,555,370 L732P probably damaging Het
Pskh1 A G 8: 105,912,985 D99G possibly damaging Het
Rest A G 5: 77,281,224 T497A probably benign Het
Rps24 C T 14: 24,493,462 T108M possibly damaging Het
Rtel1 C T 2: 181,351,682 R566C probably damaging Het
Scyl2 A G 10: 89,657,857 S350P possibly damaging Het
Slc38a7 G T 8: 95,837,674 probably null Het
Sox5 A G 6: 143,833,283 I674T probably benign Het
Surf4 C A 2: 26,926,887 E39D probably damaging Het
Tas2r144 T A 6: 42,215,357 Y10* probably null Het
Thbs4 C T 13: 92,774,707 G323R probably damaging Het
Top2b A G 14: 16,399,006 Y542C probably damaging Het
Trim61 A G 8: 65,014,456 V51A probably benign Het
Tyrp1 T A 4: 80,850,772 I501N possibly damaging Het
U2surp C T 9: 95,500,816 D32N probably benign Het
Ush1c T C 7: 46,214,959 Y411C probably damaging Het
Vwa7 G A 17: 35,023,389 V490I probably benign Het
Xylt1 G T 7: 117,667,305 A849S probably benign Het
Ythdc1 T A 5: 86,831,956 N599K possibly damaging Het
Zbtb38 T A 9: 96,685,992 Y1013F probably damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Zswim9 T C 7: 13,260,977 S418G probably damaging Het
Other mutations in Agmo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00988:Agmo APN 12 37357717 missense probably damaging 1.00
IGL01412:Agmo APN 12 37402141 missense possibly damaging 0.49
IGL01682:Agmo APN 12 37357627 splice site probably benign
IGL02263:Agmo APN 12 37357697 missense probably damaging 1.00
IGL02478:Agmo APN 12 37401986 missense probably damaging 1.00
IGL02803:Agmo APN 12 37252481 missense probably benign 0.00
R0664:Agmo UTSW 12 37252572 missense probably damaging 1.00
R2158:Agmo UTSW 12 37357710 missense probably damaging 1.00
R3440:Agmo UTSW 12 37243800 missense probably damaging 1.00
R5263:Agmo UTSW 12 37357681 missense probably benign 0.01
R6251:Agmo UTSW 12 37252539 missense probably damaging 1.00
R7513:Agmo UTSW 12 37244353 missense probably benign 0.01
R7686:Agmo UTSW 12 37419974 missense probably benign 0.00
R7729:Agmo UTSW 12 37414975 missense probably benign 0.00
R7731:Agmo UTSW 12 37414940 missense probably benign 0.01
R7849:Agmo UTSW 12 37242045 missense probably benign 0.03
R7852:Agmo UTSW 12 37242052 missense possibly damaging 0.92
R7932:Agmo UTSW 12 37242045 missense probably benign 0.03
R7935:Agmo UTSW 12 37242052 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TAGCCTTCCCAGATATCAGAGAACTG -3'
(R):5'- AACACTAGGGATATTGAGCATTCTC -3'

Sequencing Primer
(F):5'- GACTTGATATGGATCAGAATAGCATC -3'
(R):5'- GGTCCTGAACTTTTAGAAATTT -3'
Posted On2018-02-28