Incidental Mutation 'R6249:Rps24'
ID505874
Institutional Source Beutler Lab
Gene Symbol Rps24
Ensembl Gene ENSMUSG00000025290
Gene Nameribosomal protein S24
SynonymsMRP S24
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.760) question?
Stock #R6249 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location24487125-24496959 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 24493462 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 108 (T108M)
Ref Sequence ENSEMBL: ENSMUSP00000153637 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112384] [ENSMUST00000169826] [ENSMUST00000223999] [ENSMUST00000224568] [ENSMUST00000225023]
Predicted Effect possibly damaging
Transcript: ENSMUST00000112384
AA Change: T120M

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108003
Gene: ENSMUSG00000025290
AA Change: T120M

DomainStartEndE-ValueType
Pfam:Ribosomal_S24e 23 108 4.4e-41 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000169826
AA Change: T120M

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125977
Gene: ENSMUSG00000025290
AA Change: T120M

DomainStartEndE-ValueType
Pfam:Ribosomal_S24e 24 102 1.9e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223931
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223939
Predicted Effect possibly damaging
Transcript: ENSMUST00000223999
AA Change: T120M

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224549
Predicted Effect possibly damaging
Transcript: ENSMUST00000224568
AA Change: T108M

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224569
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224699
Predicted Effect possibly damaging
Transcript: ENSMUST00000225023
AA Change: T120M

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225117
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225994
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S24E family of ribosomal proteins. It is located in the cytoplasm. Multiple transcript variants encoding different isoforms have been found for this gene. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Mutations in this gene result in Diamond-Blackfan anemia. [provided by RefSeq, Nov 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004F10Rik A T 7: 116,103,270 S90C probably damaging Het
Abca9 T C 11: 110,145,627 D552G probably benign Het
Adgrb3 A G 1: 25,432,558 L502P probably damaging Het
Agmo T C 12: 37,243,838 probably null Het
Ank3 A G 10: 69,823,076 probably null Het
Apol11b G T 15: 77,635,337 T181K probably benign Het
Arap2 G T 5: 62,646,193 H1244N probably damaging Het
Arid1b A T 17: 5,279,361 M838L possibly damaging Het
Aste1 G A 9: 105,396,617 V19I probably benign Het
B3gnt3 A T 8: 71,692,662 M354K probably damaging Het
Calcr A T 6: 3,692,711 M381K possibly damaging Het
Ccdc63 A C 5: 122,124,999 L160W probably benign Het
Cerkl A G 2: 79,368,778 L156P probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Ddb1 C A 19: 10,605,720 Y5* probably null Het
Fam205a1 A T 4: 42,850,528 W543R probably benign Het
Fignl2 T C 15: 101,054,179 E74G possibly damaging Het
Glb1l2 C T 9: 26,765,554 probably benign Het
Gm10031 A G 1: 156,525,230 M334V probably benign Het
Gm16503 A G 4: 147,541,051 M1V probably null Het
Gm2696 A C 10: 77,794,812 probably benign Het
Gm45844 A G 7: 7,240,093 S20P probably benign Het
Gm7579 C T 7: 142,212,006 P50S unknown Het
Idh1 A G 1: 65,166,219 S196P probably damaging Het
Il1rap T C 16: 26,692,848 V214A possibly damaging Het
Kctd17 C G 15: 78,430,039 probably null Het
Lama1 G T 17: 67,798,604 V2036L probably benign Het
Lars G T 18: 42,257,206 probably null Het
Mdn1 T A 4: 32,708,484 V1670E possibly damaging Het
Mtmr7 A T 8: 40,581,482 I266N probably damaging Het
Ncapd3 GGCTGCTGCTGCTGCTGCTGCTG GGCTGCTGCTGCTGCTGCTG 9: 27,088,053 probably benign Het
Nckap5 T C 1: 126,024,930 E1295G probably benign Het
Nrxn3 T A 12: 89,254,678 V409D probably damaging Het
Olfr1341 A G 4: 118,709,713 Y102C probably damaging Het
Olfr169 T A 16: 19,565,975 N303Y probably damaging Het
Olfr190 T C 16: 59,074,432 Y216C probably damaging Het
Olfr448 G T 6: 42,897,304 L284F probably damaging Het
Olfr635 A T 7: 103,979,611 S140C possibly damaging Het
Olfr907 T G 9: 38,499,584 I305R unknown Het
Pcdha4 T A 18: 36,953,676 V304E probably damaging Het
Pde6c T C 19: 38,158,560 probably null Het
Pebp4 A T 14: 70,059,650 T213S possibly damaging Het
Phf2 C A 13: 48,805,872 R886L unknown Het
Pik3ca A T 3: 32,461,563 H795L probably damaging Het
Pisd G T 5: 32,738,844 T379N probably damaging Het
Pld2 T C 11: 70,555,370 L732P probably damaging Het
Pskh1 A G 8: 105,912,985 D99G possibly damaging Het
Rest A G 5: 77,281,224 T497A probably benign Het
Rtel1 C T 2: 181,351,682 R566C probably damaging Het
Scyl2 A G 10: 89,657,857 S350P possibly damaging Het
Slc38a7 G T 8: 95,837,674 probably null Het
Sox5 A G 6: 143,833,283 I674T probably benign Het
Surf4 C A 2: 26,926,887 E39D probably damaging Het
Tas2r144 T A 6: 42,215,357 Y10* probably null Het
Thbs4 C T 13: 92,774,707 G323R probably damaging Het
Top2b A G 14: 16,399,006 Y542C probably damaging Het
Trim61 A G 8: 65,014,456 V51A probably benign Het
Tyrp1 T A 4: 80,850,772 I501N possibly damaging Het
U2surp C T 9: 95,500,816 D32N probably benign Het
Ush1c T C 7: 46,214,959 Y411C probably damaging Het
Vwa7 G A 17: 35,023,389 V490I probably benign Het
Xylt1 G T 7: 117,667,305 A849S probably benign Het
Ythdc1 T A 5: 86,831,956 N599K possibly damaging Het
Zbtb38 T A 9: 96,685,992 Y1013F probably damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Zswim9 T C 7: 13,260,977 S418G probably damaging Het
Other mutations in Rps24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02049:Rps24 APN 14 24491755 missense probably benign
R1209:Rps24 UTSW 14 24491762 missense probably damaging 1.00
R1317:Rps24 UTSW 14 24491762 missense probably damaging 1.00
R1363:Rps24 UTSW 14 24491762 missense probably damaging 1.00
R1365:Rps24 UTSW 14 24491762 missense probably damaging 1.00
R1393:Rps24 UTSW 14 24491762 missense probably damaging 1.00
R1427:Rps24 UTSW 14 24491762 missense probably damaging 1.00
R1429:Rps24 UTSW 14 24491762 missense probably damaging 1.00
R1771:Rps24 UTSW 14 24491762 missense probably damaging 1.00
R1776:Rps24 UTSW 14 24491762 missense probably damaging 1.00
R2916:Rps24 UTSW 14 24491941 missense probably benign 0.02
R4837:Rps24 UTSW 14 24491787 missense possibly damaging 0.93
R6146:Rps24 UTSW 14 24490735 start gained probably null
R6386:Rps24 UTSW 14 24492048 missense possibly damaging 0.79
R7316:Rps24 UTSW 14 24490689 unclassified probably benign
V7732:Rps24 UTSW 14 24491762 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAGATGCTGAGCAGTGTTG -3'
(R):5'- CAGAGCTTCTCAAAACGTTACC -3'

Sequencing Primer
(F):5'- TGGAACTCACTCTGTAGACCAGG -3'
(R):5'- AGAGCTTCTCAAAACGTTACCTTCTG -3'
Posted On2018-02-28