Incidental Mutation 'R6249:Lars'
ID505886
Institutional Source Beutler Lab
Gene Symbol Lars
Ensembl Gene ENSMUSG00000024493
Gene Nameleucyl-tRNA synthetase
Synonyms2310045K21Rik, 3110009L02Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6249 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location42202350-42262122 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to T at 42257206 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000095197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097590] [ENSMUST00000097590]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000091925
Predicted Effect probably null
Transcript: ENSMUST00000097590
SMART Domains Protein: ENSMUSP00000095197
Gene: ENSMUSG00000024493

DomainStartEndE-ValueType
Pfam:tRNA-synt_1 19 112 5.8e-12 PFAM
Pfam:tRNA-synt_1g 48 114 3.5e-7 PFAM
low complexity region 141 157 N/A INTRINSIC
Pfam:tRNA-synt_1 173 758 3.6e-26 PFAM
Pfam:tRNA-synt_1g 632 764 1e-9 PFAM
Pfam:tRNA-synt_1e 660 761 2.8e-7 PFAM
Pfam:Anticodon_1 796 930 3e-18 PFAM
Blast:IL1 950 1086 4e-37 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000097590
SMART Domains Protein: ENSMUSP00000095197
Gene: ENSMUSG00000024493

DomainStartEndE-ValueType
Pfam:tRNA-synt_1 19 112 5.8e-12 PFAM
Pfam:tRNA-synt_1g 48 114 3.5e-7 PFAM
low complexity region 141 157 N/A INTRINSIC
Pfam:tRNA-synt_1 173 758 3.6e-26 PFAM
Pfam:tRNA-synt_1g 632 764 1e-9 PFAM
Pfam:tRNA-synt_1e 660 761 2.8e-7 PFAM
Pfam:Anticodon_1 796 930 3e-18 PFAM
Blast:IL1 950 1086 4e-37 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytosolic leucine-tRNA synthetase, a member of the class I aminoacyl-tRNA synthetase family. The encoded enzyme catalyzes the ATP-dependent ligation of L-leucine to tRNA(Leu). It is found in the cytoplasm as part of a multisynthetase complex and interacts with the arginine tRNA synthetase through its C-terminal domain. A mutation in this gene was found in affected individuals with infantile liver failure syndrome 1. Alternatively spliced transcript variants of this gene have been observed. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004F10Rik A T 7: 116,103,270 S90C probably damaging Het
Abca9 T C 11: 110,145,627 D552G probably benign Het
Adgrb3 A G 1: 25,432,558 L502P probably damaging Het
Agmo T C 12: 37,243,838 probably null Het
Ank3 A G 10: 69,823,076 probably null Het
Apol11b G T 15: 77,635,337 T181K probably benign Het
Arap2 G T 5: 62,646,193 H1244N probably damaging Het
Arid1b A T 17: 5,279,361 M838L possibly damaging Het
Aste1 G A 9: 105,396,617 V19I probably benign Het
B3gnt3 A T 8: 71,692,662 M354K probably damaging Het
Calcr A T 6: 3,692,711 M381K possibly damaging Het
Ccdc63 A C 5: 122,124,999 L160W probably benign Het
Cerkl A G 2: 79,368,778 L156P probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Ddb1 C A 19: 10,605,720 Y5* probably null Het
Fam205a1 A T 4: 42,850,528 W543R probably benign Het
Fignl2 T C 15: 101,054,179 E74G possibly damaging Het
Glb1l2 C T 9: 26,765,554 probably benign Het
Gm10031 A G 1: 156,525,230 M334V probably benign Het
Gm16503 A G 4: 147,541,051 M1V probably null Het
Gm2696 A C 10: 77,794,812 probably benign Het
Gm45844 A G 7: 7,240,093 S20P probably benign Het
Gm7579 C T 7: 142,212,006 P50S unknown Het
Idh1 A G 1: 65,166,219 S196P probably damaging Het
Il1rap T C 16: 26,692,848 V214A possibly damaging Het
Kctd17 C G 15: 78,430,039 probably null Het
Lama1 G T 17: 67,798,604 V2036L probably benign Het
Mdn1 T A 4: 32,708,484 V1670E possibly damaging Het
Mtmr7 A T 8: 40,581,482 I266N probably damaging Het
Ncapd3 GGCTGCTGCTGCTGCTGCTGCTG GGCTGCTGCTGCTGCTGCTG 9: 27,088,053 probably benign Het
Nckap5 T C 1: 126,024,930 E1295G probably benign Het
Nrxn3 T A 12: 89,254,678 V409D probably damaging Het
Olfr1341 A G 4: 118,709,713 Y102C probably damaging Het
Olfr169 T A 16: 19,565,975 N303Y probably damaging Het
Olfr190 T C 16: 59,074,432 Y216C probably damaging Het
Olfr448 G T 6: 42,897,304 L284F probably damaging Het
Olfr635 A T 7: 103,979,611 S140C possibly damaging Het
Olfr907 T G 9: 38,499,584 I305R unknown Het
Pcdha4 T A 18: 36,953,676 V304E probably damaging Het
Pde6c T C 19: 38,158,560 probably null Het
Pebp4 A T 14: 70,059,650 T213S possibly damaging Het
Phf2 C A 13: 48,805,872 R886L unknown Het
Pik3ca A T 3: 32,461,563 H795L probably damaging Het
Pisd G T 5: 32,738,844 T379N probably damaging Het
Pld2 T C 11: 70,555,370 L732P probably damaging Het
Pskh1 A G 8: 105,912,985 D99G possibly damaging Het
Rest A G 5: 77,281,224 T497A probably benign Het
Rps24 C T 14: 24,493,462 T108M possibly damaging Het
Rtel1 C T 2: 181,351,682 R566C probably damaging Het
Scyl2 A G 10: 89,657,857 S350P possibly damaging Het
Slc38a7 G T 8: 95,837,674 probably null Het
Sox5 A G 6: 143,833,283 I674T probably benign Het
Surf4 C A 2: 26,926,887 E39D probably damaging Het
Tas2r144 T A 6: 42,215,357 Y10* probably null Het
Thbs4 C T 13: 92,774,707 G323R probably damaging Het
Top2b A G 14: 16,399,006 Y542C probably damaging Het
Trim61 A G 8: 65,014,456 V51A probably benign Het
Tyrp1 T A 4: 80,850,772 I501N possibly damaging Het
U2surp C T 9: 95,500,816 D32N probably benign Het
Ush1c T C 7: 46,214,959 Y411C probably damaging Het
Vwa7 G A 17: 35,023,389 V490I probably benign Het
Xylt1 G T 7: 117,667,305 A849S probably benign Het
Ythdc1 T A 5: 86,831,956 N599K possibly damaging Het
Zbtb38 T A 9: 96,685,992 Y1013F probably damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Zswim9 T C 7: 13,260,977 S418G probably damaging Het
Other mutations in Lars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00534:Lars APN 18 42229654 missense probably damaging 0.99
IGL01340:Lars APN 18 42202577 missense probably benign 0.01
IGL01397:Lars APN 18 42228029 missense probably damaging 1.00
IGL01510:Lars APN 18 42242109 missense probably benign
IGL01542:Lars APN 18 42214827 missense probably benign 0.09
IGL01689:Lars APN 18 42216949 missense probably benign
IGL01819:Lars APN 18 42202550 missense probably benign 0.00
IGL02142:Lars APN 18 42227280 missense probably benign 0.01
IGL02598:Lars APN 18 42227277 missense possibly damaging 0.61
IGL02630:Lars APN 18 42257169 missense probably damaging 0.97
IGL02973:Lars APN 18 42214759 critical splice donor site probably null
IGL03064:Lars APN 18 42221571 nonsense probably null
IGL03081:Lars APN 18 42210091 missense probably benign 0.00
IGL03330:Lars APN 18 42219944 missense probably benign
IGL03334:Lars APN 18 42221506 missense probably benign
IGL03340:Lars APN 18 42228650 splice site probably benign
R0165:Lars UTSW 18 42202697 missense possibly damaging 0.91
R0321:Lars UTSW 18 42202632 missense probably damaging 0.96
R0325:Lars UTSW 18 42250902 missense possibly damaging 0.88
R0391:Lars UTSW 18 42251363 missense probably benign 0.00
R0558:Lars UTSW 18 42214837 missense probably benign
R0624:Lars UTSW 18 42242784 splice site probably benign
R0881:Lars UTSW 18 42214786 missense probably benign 0.22
R0968:Lars UTSW 18 42218583 missense probably benign 0.09
R1457:Lars UTSW 18 42210050 missense probably damaging 1.00
R1466:Lars UTSW 18 42210050 missense probably damaging 1.00
R1466:Lars UTSW 18 42210050 missense probably damaging 1.00
R1583:Lars UTSW 18 42210050 missense probably damaging 1.00
R1584:Lars UTSW 18 42210050 missense probably damaging 1.00
R1851:Lars UTSW 18 42212608 missense probably benign 0.09
R1852:Lars UTSW 18 42212608 missense probably benign 0.09
R1868:Lars UTSW 18 42214837 missense probably benign 0.04
R1954:Lars UTSW 18 42210050 missense probably damaging 1.00
R2277:Lars UTSW 18 42235502 missense probably benign 0.00
R3732:Lars UTSW 18 42212602 missense probably benign 0.00
R3732:Lars UTSW 18 42212602 missense probably benign 0.00
R3733:Lars UTSW 18 42212602 missense probably benign 0.00
R4208:Lars UTSW 18 42229703 missense probably benign 0.34
R4571:Lars UTSW 18 42228230 splice site probably null
R5009:Lars UTSW 18 42221547 missense probably benign 0.03
R5033:Lars UTSW 18 42214776 missense possibly damaging 0.92
R5152:Lars UTSW 18 42228777 missense possibly damaging 0.96
R5208:Lars UTSW 18 42217557 missense probably benign
R5219:Lars UTSW 18 42234720 missense probably benign 0.44
R5396:Lars UTSW 18 42216959 missense probably benign
R5433:Lars UTSW 18 42251298 missense possibly damaging 0.66
R5580:Lars UTSW 18 42214851 missense probably damaging 0.98
R5610:Lars UTSW 18 42257091 missense probably benign
R5784:Lars UTSW 18 42219899 missense probably benign 0.00
R6334:Lars UTSW 18 42217486 missense probably benign
R6618:Lars UTSW 18 42244908 missense possibly damaging 0.86
R6900:Lars UTSW 18 42234610 missense probably benign
R6958:Lars UTSW 18 42236639 missense probably damaging 1.00
R7390:Lars UTSW 18 42210018 critical splice donor site probably null
R7451:Lars UTSW 18 42202550 missense probably benign 0.00
R7618:Lars UTSW 18 42244891 missense probably benign 0.10
R7831:Lars UTSW 18 42217562 missense probably benign 0.24
R7971:Lars UTSW 18 42218566 missense probably benign 0.06
R8003:Lars UTSW 18 42221619 missense probably damaging 1.00
R8082:Lars UTSW 18 42244910 missense probably damaging 0.98
R8144:Lars UTSW 18 42218526 missense probably damaging 0.98
R8181:Lars UTSW 18 42228770 missense probably damaging 0.98
R8196:Lars UTSW 18 42210101 missense possibly damaging 0.77
R8309:Lars UTSW 18 42243028 missense possibly damaging 0.54
X0064:Lars UTSW 18 42228060 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AGACATTGTCTCACTTTCTGGC -3'
(R):5'- AGCTGTCAGTGAGCAGCTTG -3'

Sequencing Primer
(F):5'- TGGCCTCCCTCGTCCTG -3'
(R):5'- CAGTGAGCAGCTTGGTTCTTTG -3'
Posted On2018-02-28