Incidental Mutation 'R6250:Abhd12'
ID505895
Institutional Source Beutler Lab
Gene Symbol Abhd12
Ensembl Gene ENSMUSG00000032046
Gene Nameabhydrolase domain containing 12
Synonyms
MMRRC Submission 044367-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.192) question?
Stock #R6250 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location150832493-150904741 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 150839747 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 241 (Y241C)
Ref Sequence ENSEMBL: ENSMUSP00000122763 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056149] [ENSMUST00000141899]
Predicted Effect probably damaging
Transcript: ENSMUST00000056149
AA Change: Y241C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053558
Gene: ENSMUSG00000032046
AA Change: Y241C

DomainStartEndE-ValueType
low complexity region 15 36 N/A INTRINSIC
transmembrane domain 68 90 N/A INTRINSIC
Pfam:Hydrolase_4 165 297 1.2e-16 PFAM
Pfam:Abhydrolase_1 169 302 1.6e-13 PFAM
Pfam:Abhydrolase_5 170 359 2.5e-22 PFAM
Pfam:Abhydrolase_6 171 363 1.5e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138608
Predicted Effect probably damaging
Transcript: ENSMUST00000141899
AA Change: Y241C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122763
Gene: ENSMUSG00000032046
AA Change: Y241C

DomainStartEndE-ValueType
low complexity region 15 36 N/A INTRINSIC
transmembrane domain 68 90 N/A INTRINSIC
Pfam:Abhydrolase_5 170 295 1.9e-16 PFAM
Pfam:Abhydrolase_6 171 293 3.8e-15 PFAM
Pfam:Abhydrolase_3 171 295 1.1e-6 PFAM
Pfam:Abhydrolase_1 198 271 1.2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145826
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155119
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156641
Meta Mutation Damage Score 0.8499 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that catalyzes the hydrolysis of 2-arachidonoyl glycerol (2-AG), the main endocannabinoid lipid transmitter that acts on cannabinoid receptors, CB1 and CB2. The endocannabinoid system is involved in a wide range of physiological processes, including neurotransmission, mood, appetite, pain appreciation, addiction behavior, and inflammation. Mutations in this gene are associated with the neurodegenerative disease, PHARC (polyneuropathy, hearing loss, ataxia, retinitis pigmentosa, and cataract), resulting from an inborn error of endocannabinoid metabolism. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene.[provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neurological symptoms of neurodegeneration, hearing loss, ataxia, microgliosis and reduced brain lysophosphatidylserine lipase activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik G A 7: 28,150,714 G1195D probably damaging Het
Ak9 T C 10: 41,389,034 V929A possibly damaging Het
Ap3s1 T C 18: 46,754,447 F49S probably damaging Het
Atp9b T C 18: 80,756,521 H801R probably benign Het
B430218F22Rik A G 13: 118,387,408 probably benign Het
BC030867 A G 11: 102,255,062 T55A probably benign Het
Ccnd3 T A 17: 47,597,562 L186* probably null Het
Cnbd1 T A 4: 19,098,255 Q55L probably benign Het
Commd10 A G 18: 46,963,688 E54G probably damaging Het
D6Ertd527e G A 6: 87,111,212 G119D unknown Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Disp2 A T 2: 118,790,766 I660F probably damaging Het
Eef1a2 A G 2: 181,151,060 F211L possibly damaging Het
Epb41 A T 4: 131,989,873 F323L probably damaging Het
Eps8l3 A T 3: 107,890,465 I403F probably benign Het
Ercc5 T A 1: 44,164,049 V282D probably damaging Het
Faim A T 9: 98,992,123 M1L probably benign Het
Fbxo24 A G 5: 137,621,281 F111L probably damaging Het
Glrx A T 13: 75,840,110 I48F probably damaging Het
Gucy2g A T 19: 55,217,424 L668Q probably damaging Het
Hectd4 A G 5: 121,339,498 D2828G possibly damaging Het
Hivep2 T C 10: 14,131,759 V1367A probably benign Het
Ipo13 A G 4: 117,912,154 V147A possibly damaging Het
Jchain T C 5: 88,526,175 T37A probably benign Het
Kif1b A G 4: 149,213,643 V1034A probably benign Het
Krt25 T A 11: 99,321,163 N216I probably damaging Het
Lman1l A G 9: 57,615,624 V151A probably benign Het
Mfsd4b1 T C 10: 40,003,110 S264G possibly damaging Het
Mxra8 G T 4: 155,841,089 R82L possibly damaging Het
Nlrp1b A T 11: 71,181,799 I406N probably benign Het
Olfr1381 A T 11: 49,551,884 I46F probably damaging Het
Olfr155 T C 4: 43,854,363 L18P possibly damaging Het
Olfr191 G A 16: 59,085,832 S217F probably damaging Het
Pak7 T C 2: 136,174,269 probably benign Het
Pcsk4 T C 10: 80,325,592 R222G probably benign Het
Pik3cb A C 9: 99,094,598 F149V probably benign Het
Plscr4 G A 9: 92,484,828 R165Q possibly damaging Het
Ppp2r2a A T 14: 67,038,954 V34E probably damaging Het
Prpf8 T G 11: 75,493,508 S659R possibly damaging Het
Ptprd A G 4: 76,128,995 S342P probably damaging Het
Pum2 T C 12: 8,744,755 probably null Het
Ranbp3 T G 17: 56,677,208 probably null Het
Rassf7 A G 7: 141,217,243 E123G probably damaging Het
Rcor1 G T 12: 111,111,877 A469S probably benign Het
Rcor3 G T 1: 192,100,896 P524Q probably damaging Het
Rnf44 A T 13: 54,682,107 probably null Het
Rtf1 T C 2: 119,675,177 V37A unknown Het
Sdc4 A T 2: 164,431,218 D57E probably damaging Het
Setbp1 T C 18: 78,858,002 T817A probably benign Het
Setd1a A G 7: 127,791,299 E506G unknown Het
Slc30a8 G A 15: 52,335,149 R330Q probably benign Het
Snx22 C A 9: 66,069,641 E14* probably null Het
Spata31d1a A G 13: 59,701,801 S838P possibly damaging Het
Sprr4 G T 3: 92,500,463 Q11K unknown Het
Trpm3 A G 19: 22,910,054 N839S probably benign Het
Vps9d1 T C 8: 123,248,208 probably null Het
Vwa3b T C 1: 37,051,885 probably null Het
Ythdf1 T C 2: 180,911,100 T414A probably damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Other mutations in Abhd12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02158:Abhd12 APN 2 150848421 missense probably benign 0.00
IGL02399:Abhd12 APN 2 150858493 splice site probably benign
IGL02437:Abhd12 APN 2 150834369 missense probably benign 0.01
IGL02981:Abhd12 APN 2 150833124 missense probably benign
R0423:Abhd12 UTSW 2 150838392 missense possibly damaging 0.89
R0617:Abhd12 UTSW 2 150846365 critical splice acceptor site probably null
R0745:Abhd12 UTSW 2 150833148 splice site probably null
R1651:Abhd12 UTSW 2 150848421 missense probably benign 0.00
R1829:Abhd12 UTSW 2 150843398 missense probably damaging 1.00
R1832:Abhd12 UTSW 2 150848418 missense probably damaging 0.97
R1833:Abhd12 UTSW 2 150848418 missense probably damaging 0.97
R2298:Abhd12 UTSW 2 150901494 intron probably benign
R3153:Abhd12 UTSW 2 150834355 missense probably benign 0.21
R4077:Abhd12 UTSW 2 150848459 critical splice acceptor site probably null
R4508:Abhd12 UTSW 2 150904355 critical splice donor site probably benign
R5193:Abhd12 UTSW 2 150835306 makesense probably null
R5898:Abhd12 UTSW 2 150839778 missense possibly damaging 0.89
Z1177:Abhd12 UTSW 2 150904414 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CCATGCCCATATTGGTTCTAAGG -3'
(R):5'- TCATGGGGCAGCTTTCACTG -3'

Sequencing Primer
(F):5'- AGGCACTTCTGAACTTCAGTC -3'
(R):5'- CACTGGAGCTGCTGTAAGTTCAC -3'
Posted On2018-02-28