Incidental Mutation 'R6250:Eef1a2'
ID505898
Institutional Source Beutler Lab
Gene Symbol Eef1a2
Ensembl Gene ENSMUSG00000016349
Gene Nameeukaryotic translation elongation factor 1 alpha 2
SynonymsEef1a, S1
MMRRC Submission 044367-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6250 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location181147653-181157014 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 181151060 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 211 (F211L)
Ref Sequence ENSEMBL: ENSMUSP00000054556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055990]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055990
AA Change: F211L

PolyPhen 2 Score 0.701 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000054556
Gene: ENSMUSG00000016349
AA Change: F211L

DomainStartEndE-ValueType
Pfam:GTP_EFTU 5 238 5.3e-56 PFAM
Pfam:GTP_EFTU_D2 260 327 1.5e-15 PFAM
Pfam:GTP_EFTU_D3 333 442 8.4e-42 PFAM
Meta Mutation Damage Score 0.4799 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an isoform of the alpha subunit of the elongation factor-1 complex, which is responsible for the enzymatic delivery of aminoacyl tRNAs to the ribosome. This isoform (alpha 2) is expressed in brain, heart and skeletal muscle, and the other isoform (alpha 1) is expressed in brain, placenta, lung, liver, kidney, and pancreas. This gene may be critical in the development of ovarian cancer. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit muscle wasting, lymphoid hypoplasia, lack of intestinal IgA plasma cells, cerebellar dysfunction, neurodegeneration, an age-dependent increase in chromosomal aberrations, and lethality around 28 days of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik G A 7: 28,150,714 G1195D probably damaging Het
Abhd12 T C 2: 150,839,747 Y241C probably damaging Het
Ak9 T C 10: 41,389,034 V929A possibly damaging Het
Ap3s1 T C 18: 46,754,447 F49S probably damaging Het
Atp9b T C 18: 80,756,521 H801R probably benign Het
B430218F22Rik A G 13: 118,387,408 probably benign Het
BC030867 A G 11: 102,255,062 T55A probably benign Het
Ccnd3 T A 17: 47,597,562 L186* probably null Het
Cnbd1 T A 4: 19,098,255 Q55L probably benign Het
Commd10 A G 18: 46,963,688 E54G probably damaging Het
D6Ertd527e G A 6: 87,111,212 G119D unknown Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Disp2 A T 2: 118,790,766 I660F probably damaging Het
Epb41 A T 4: 131,989,873 F323L probably damaging Het
Eps8l3 A T 3: 107,890,465 I403F probably benign Het
Ercc5 T A 1: 44,164,049 V282D probably damaging Het
Faim A T 9: 98,992,123 M1L probably benign Het
Fbxo24 A G 5: 137,621,281 F111L probably damaging Het
Glrx A T 13: 75,840,110 I48F probably damaging Het
Gucy2g A T 19: 55,217,424 L668Q probably damaging Het
Hectd4 A G 5: 121,339,498 D2828G possibly damaging Het
Hivep2 T C 10: 14,131,759 V1367A probably benign Het
Ipo13 A G 4: 117,912,154 V147A possibly damaging Het
Jchain T C 5: 88,526,175 T37A probably benign Het
Kif1b A G 4: 149,213,643 V1034A probably benign Het
Krt25 T A 11: 99,321,163 N216I probably damaging Het
Lman1l A G 9: 57,615,624 V151A probably benign Het
Mfsd4b1 T C 10: 40,003,110 S264G possibly damaging Het
Mxra8 G T 4: 155,841,089 R82L possibly damaging Het
Nlrp1b A T 11: 71,181,799 I406N probably benign Het
Olfr1381 A T 11: 49,551,884 I46F probably damaging Het
Olfr155 T C 4: 43,854,363 L18P possibly damaging Het
Olfr191 G A 16: 59,085,832 S217F probably damaging Het
Pak7 T C 2: 136,174,269 probably benign Het
Pcsk4 T C 10: 80,325,592 R222G probably benign Het
Pik3cb A C 9: 99,094,598 F149V probably benign Het
Plscr4 G A 9: 92,484,828 R165Q possibly damaging Het
Ppp2r2a A T 14: 67,038,954 V34E probably damaging Het
Prpf8 T G 11: 75,493,508 S659R possibly damaging Het
Ptprd A G 4: 76,128,995 S342P probably damaging Het
Pum2 T C 12: 8,744,755 probably null Het
Ranbp3 T G 17: 56,677,208 probably null Het
Rassf7 A G 7: 141,217,243 E123G probably damaging Het
Rcor1 G T 12: 111,111,877 A469S probably benign Het
Rcor3 G T 1: 192,100,896 P524Q probably damaging Het
Rnf44 A T 13: 54,682,107 probably null Het
Rtf1 T C 2: 119,675,177 V37A unknown Het
Sdc4 A T 2: 164,431,218 D57E probably damaging Het
Setbp1 T C 18: 78,858,002 T817A probably benign Het
Setd1a A G 7: 127,791,299 E506G unknown Het
Slc30a8 G A 15: 52,335,149 R330Q probably benign Het
Snx22 C A 9: 66,069,641 E14* probably null Het
Spata31d1a A G 13: 59,701,801 S838P possibly damaging Het
Sprr4 G T 3: 92,500,463 Q11K unknown Het
Trpm3 A G 19: 22,910,054 N839S probably benign Het
Vps9d1 T C 8: 123,248,208 probably null Het
Vwa3b T C 1: 37,051,885 probably null Het
Ythdf1 T C 2: 180,911,100 T414A probably damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Other mutations in Eef1a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00741:Eef1a2 APN 2 181153010 missense possibly damaging 0.95
IGL02098:Eef1a2 APN 2 181152789 missense probably benign
IGL02717:Eef1a2 APN 2 181152901 missense probably benign
IGL03264:Eef1a2 APN 2 181148734 missense possibly damaging 0.89
IGL03308:Eef1a2 APN 2 181148836 splice site probably benign
R1680:Eef1a2 UTSW 2 181152941 missense possibly damaging 0.84
R2140:Eef1a2 UTSW 2 181148742 missense probably benign 0.03
R3877:Eef1a2 UTSW 2 181152833 missense probably damaging 0.99
R4706:Eef1a2 UTSW 2 181155357 missense probably damaging 0.96
R4902:Eef1a2 UTSW 2 181148088 missense probably benign 0.02
R5846:Eef1a2 UTSW 2 181152983 missense probably damaging 1.00
R6864:Eef1a2 UTSW 2 181149684 missense probably benign 0.00
R6991:Eef1a2 UTSW 2 181148628 missense possibly damaging 0.70
X0027:Eef1a2 UTSW 2 181151036 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- TCCTAGTCAGGGTTTGGAGC -3'
(R):5'- ATTAGGGAATCAGGCCAGGC -3'

Sequencing Primer
(F):5'- CTAGTCAGGGTTTGGAGCAGAGTAG -3'
(R):5'- TCCCTGTGAGGCTAGGAAG -3'
Posted On2018-02-28