Incidental Mutation 'R6250:Olfr155'
ID505902
Institutional Source Beutler Lab
Gene Symbol Olfr155
Ensembl Gene ENSMUSG00000071000
Gene Nameolfactory receptor 155
SynonymsOR37A, Olfr37a, GA_x6K02T2N78B-16092200-16091241, mOR37a, MOR262-14
MMRRC Submission 044367-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R6250 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location43851565-43857595 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43854363 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 18 (L18P)
Ref Sequence ENSEMBL: ENSMUSP00000103492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095108] [ENSMUST00000107860]
Predicted Effect possibly damaging
Transcript: ENSMUST00000095108
AA Change: L18P

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000092726
Gene: ENSMUSG00000071000
AA Change: L18P

DomainStartEndE-ValueType
Pfam:7tm_1 42 297 2.8e-35 PFAM
Pfam:7tm_4 140 290 1.4e-45 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000107860
AA Change: L18P

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000103492
Gene: ENSMUSG00000071000
AA Change: L18P

DomainStartEndE-ValueType
Pfam:7tm_4 32 315 9.7e-59 PFAM
Pfam:7tm_1 42 297 3.5e-25 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik G A 7: 28,150,714 G1195D probably damaging Het
Abhd12 T C 2: 150,839,747 Y241C probably damaging Het
Ak9 T C 10: 41,389,034 V929A possibly damaging Het
Ap3s1 T C 18: 46,754,447 F49S probably damaging Het
Atp9b T C 18: 80,756,521 H801R probably benign Het
B430218F22Rik A G 13: 118,387,408 probably benign Het
BC030867 A G 11: 102,255,062 T55A probably benign Het
Ccnd3 T A 17: 47,597,562 L186* probably null Het
Cnbd1 T A 4: 19,098,255 Q55L probably benign Het
Commd10 A G 18: 46,963,688 E54G probably damaging Het
D6Ertd527e G A 6: 87,111,212 G119D unknown Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Disp2 A T 2: 118,790,766 I660F probably damaging Het
Eef1a2 A G 2: 181,151,060 F211L possibly damaging Het
Epb41 A T 4: 131,989,873 F323L probably damaging Het
Eps8l3 A T 3: 107,890,465 I403F probably benign Het
Ercc5 T A 1: 44,164,049 V282D probably damaging Het
Faim A T 9: 98,992,123 M1L probably benign Het
Fbxo24 A G 5: 137,621,281 F111L probably damaging Het
Glrx A T 13: 75,840,110 I48F probably damaging Het
Gucy2g A T 19: 55,217,424 L668Q probably damaging Het
Hectd4 A G 5: 121,339,498 D2828G possibly damaging Het
Hivep2 T C 10: 14,131,759 V1367A probably benign Het
Ipo13 A G 4: 117,912,154 V147A possibly damaging Het
Jchain T C 5: 88,526,175 T37A probably benign Het
Kif1b A G 4: 149,213,643 V1034A probably benign Het
Krt25 T A 11: 99,321,163 N216I probably damaging Het
Lman1l A G 9: 57,615,624 V151A probably benign Het
Mfsd4b1 T C 10: 40,003,110 S264G possibly damaging Het
Mxra8 G T 4: 155,841,089 R82L possibly damaging Het
Nlrp1b A T 11: 71,181,799 I406N probably benign Het
Olfr1381 A T 11: 49,551,884 I46F probably damaging Het
Olfr191 G A 16: 59,085,832 S217F probably damaging Het
Pak7 T C 2: 136,174,269 probably benign Het
Pcsk4 T C 10: 80,325,592 R222G probably benign Het
Pik3cb A C 9: 99,094,598 F149V probably benign Het
Plscr4 G A 9: 92,484,828 R165Q possibly damaging Het
Ppp2r2a A T 14: 67,038,954 V34E probably damaging Het
Prpf8 T G 11: 75,493,508 S659R possibly damaging Het
Ptprd A G 4: 76,128,995 S342P probably damaging Het
Pum2 T C 12: 8,744,755 probably null Het
Ranbp3 T G 17: 56,677,208 probably null Het
Rassf7 A G 7: 141,217,243 E123G probably damaging Het
Rcor1 G T 12: 111,111,877 A469S probably benign Het
Rcor3 G T 1: 192,100,896 P524Q probably damaging Het
Rnf44 A T 13: 54,682,107 probably null Het
Rtf1 T C 2: 119,675,177 V37A unknown Het
Sdc4 A T 2: 164,431,218 D57E probably damaging Het
Setbp1 T C 18: 78,858,002 T817A probably benign Het
Setd1a A G 7: 127,791,299 E506G unknown Het
Slc30a8 G A 15: 52,335,149 R330Q probably benign Het
Snx22 C A 9: 66,069,641 E14* probably null Het
Spata31d1a A G 13: 59,701,801 S838P possibly damaging Het
Sprr4 G T 3: 92,500,463 Q11K unknown Het
Trpm3 A G 19: 22,910,054 N839S probably benign Het
Vps9d1 T C 8: 123,248,208 probably null Het
Vwa3b T C 1: 37,051,885 probably null Het
Ythdf1 T C 2: 180,911,100 T414A probably damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Other mutations in Olfr155
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02729:Olfr155 APN 4 43854439 missense probably damaging 1.00
R0240:Olfr155 UTSW 4 43854512 missense probably damaging 1.00
R0240:Olfr155 UTSW 4 43854512 missense probably damaging 1.00
R0285:Olfr155 UTSW 4 43854398 missense possibly damaging 0.46
R0427:Olfr155 UTSW 4 43854417 missense probably damaging 1.00
R4468:Olfr155 UTSW 4 43854737 missense probably benign 0.08
R4548:Olfr155 UTSW 4 43854834 missense probably damaging 1.00
R4583:Olfr155 UTSW 4 43855262 missense probably benign
R4793:Olfr155 UTSW 4 43854323 missense probably benign 0.37
R4884:Olfr155 UTSW 4 43854890 missense probably damaging 1.00
R5016:Olfr155 UTSW 4 43854596 missense probably benign 0.02
R5220:Olfr155 UTSW 4 43854624 missense possibly damaging 0.89
R5613:Olfr155 UTSW 4 43854528 missense probably damaging 0.99
R5805:Olfr155 UTSW 4 43855152 missense probably benign 0.15
R5955:Olfr155 UTSW 4 43854898 missense probably damaging 1.00
R6768:Olfr155 UTSW 4 43854351 missense probably benign 0.01
R6801:Olfr155 UTSW 4 43855206 nonsense probably null
R6835:Olfr155 UTSW 4 43854912 missense probably benign 0.00
R7510:Olfr155 UTSW 4 43854482 missense probably benign 0.20
R8013:Olfr155 UTSW 4 43854958 missense probably benign 0.00
R8014:Olfr155 UTSW 4 43854958 missense probably benign 0.00
R8312:Olfr155 UTSW 4 43854461 missense probably benign 0.04
W0251:Olfr155 UTSW 4 43855058 missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- CCAAGATTGTCAAAGGTGCC -3'
(R):5'- TCCTGGGAGTCAGAAAGCTG -3'

Sequencing Primer
(F):5'- CAAGATTGTCAAAGGTGCCTCTGG -3'
(R):5'- CTGGGAGTCAGAAAGCTGTCCAG -3'
Posted On2018-02-28