Incidental Mutation 'R6250:Zfp709'
ID505916
Institutional Source Beutler Lab
Gene Symbol Zfp709
Ensembl Gene ENSMUSG00000056019
Gene Namezinc finger protein 709
SynonymsGIOT-4
MMRRC Submission 044367-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.213) question?
Stock #R6250 (G1)
Quality Score217.468
Status Validated
Chromosome8
Chromosomal Location71882019-71895727 bp(+) (GRCm38)
Type of Mutationsmall deletion (1 aa in frame mutation)
DNA Base Change (assembly) TCGACG to TCG at 71890708 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034259] [ENSMUST00000188374] [ENSMUST00000188685]
Predicted Effect probably benign
Transcript: ENSMUST00000034259
SMART Domains Protein: ENSMUSP00000034259
Gene: ENSMUSG00000056019

DomainStartEndE-ValueType
KRAB 3 68 3.08e-15 SMART
ZnF_C2H2 224 246 6.78e-3 SMART
ZnF_C2H2 252 274 2.09e-3 SMART
ZnF_C2H2 280 302 2.05e-2 SMART
ZnF_C2H2 308 330 2.4e-3 SMART
ZnF_C2H2 336 358 1.36e-2 SMART
ZnF_C2H2 364 386 1.36e-2 SMART
ZnF_C2H2 392 414 1.69e-3 SMART
ZnF_C2H2 420 442 5.14e-3 SMART
ZnF_C2H2 448 470 1.67e-2 SMART
ZnF_C2H2 476 498 1.1e-2 SMART
ZnF_C2H2 504 526 2.86e-1 SMART
ZnF_C2H2 532 554 7.26e-3 SMART
ZnF_C2H2 560 582 8.34e-3 SMART
ZnF_C2H2 588 610 1.5e-4 SMART
ZnF_C2H2 616 638 1.18e-2 SMART
ZnF_C2H2 644 666 1.06e-4 SMART
ZnF_C2H2 672 694 1.18e-2 SMART
ZnF_C2H2 700 722 8.94e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188374
SMART Domains Protein: ENSMUSP00000141000
Gene: ENSMUSG00000056019

DomainStartEndE-ValueType
KRAB 4 56 9.2e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188685
SMART Domains Protein: ENSMUSP00000140285
Gene: ENSMUSG00000056019

DomainStartEndE-ValueType
KRAB 4 69 3.08e-15 SMART
ZnF_C2H2 225 247 6.78e-3 SMART
ZnF_C2H2 253 275 2.09e-3 SMART
ZnF_C2H2 281 303 2.05e-2 SMART
ZnF_C2H2 309 331 2.4e-3 SMART
ZnF_C2H2 337 359 1.36e-2 SMART
ZnF_C2H2 365 387 1.36e-2 SMART
ZnF_C2H2 393 415 1.69e-3 SMART
ZnF_C2H2 421 443 5.14e-3 SMART
ZnF_C2H2 449 471 1.67e-2 SMART
ZnF_C2H2 477 499 1.1e-2 SMART
ZnF_C2H2 505 527 2.86e-1 SMART
ZnF_C2H2 533 555 7.26e-3 SMART
ZnF_C2H2 561 583 8.34e-3 SMART
ZnF_C2H2 589 611 1.5e-4 SMART
ZnF_C2H2 617 639 1.18e-2 SMART
ZnF_C2H2 645 667 1.06e-4 SMART
ZnF_C2H2 673 695 1.18e-2 SMART
ZnF_C2H2 701 723 8.94e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203585
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc finger proteins (ZNFs) bind DNA and, through this binding, regulate gene transcription. Most ZNFs contain conserved C2H2 motifs and are classified as Kruppel-type zinc fingers. For a general description of these proteins, see ZNF91 (MIM 603971).[supplied by OMIM, Jul 2002]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik G A 7: 28,150,714 G1195D probably damaging Het
Abhd12 T C 2: 150,839,747 Y241C probably damaging Het
Ak9 T C 10: 41,389,034 V929A possibly damaging Het
Ap3s1 T C 18: 46,754,447 F49S probably damaging Het
Atp9b T C 18: 80,756,521 H801R probably benign Het
B430218F22Rik A G 13: 118,387,408 probably benign Het
BC030867 A G 11: 102,255,062 T55A probably benign Het
Ccnd3 T A 17: 47,597,562 L186* probably null Het
Cnbd1 T A 4: 19,098,255 Q55L probably benign Het
Commd10 A G 18: 46,963,688 E54G probably damaging Het
D6Ertd527e G A 6: 87,111,212 G119D unknown Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Disp2 A T 2: 118,790,766 I660F probably damaging Het
Eef1a2 A G 2: 181,151,060 F211L possibly damaging Het
Epb41 A T 4: 131,989,873 F323L probably damaging Het
Eps8l3 A T 3: 107,890,465 I403F probably benign Het
Ercc5 T A 1: 44,164,049 V282D probably damaging Het
Faim A T 9: 98,992,123 M1L probably benign Het
Fbxo24 A G 5: 137,621,281 F111L probably damaging Het
Glrx A T 13: 75,840,110 I48F probably damaging Het
Gucy2g A T 19: 55,217,424 L668Q probably damaging Het
Hectd4 A G 5: 121,339,498 D2828G possibly damaging Het
Hivep2 T C 10: 14,131,759 V1367A probably benign Het
Ipo13 A G 4: 117,912,154 V147A possibly damaging Het
Jchain T C 5: 88,526,175 T37A probably benign Het
Kif1b A G 4: 149,213,643 V1034A probably benign Het
Krt25 T A 11: 99,321,163 N216I probably damaging Het
Lman1l A G 9: 57,615,624 V151A probably benign Het
Mfsd4b1 T C 10: 40,003,110 S264G possibly damaging Het
Mxra8 G T 4: 155,841,089 R82L possibly damaging Het
Nlrp1b A T 11: 71,181,799 I406N probably benign Het
Olfr1381 A T 11: 49,551,884 I46F probably damaging Het
Olfr155 T C 4: 43,854,363 L18P possibly damaging Het
Olfr191 G A 16: 59,085,832 S217F probably damaging Het
Pak7 T C 2: 136,174,269 probably benign Het
Pcsk4 T C 10: 80,325,592 R222G probably benign Het
Pik3cb A C 9: 99,094,598 F149V probably benign Het
Plscr4 G A 9: 92,484,828 R165Q possibly damaging Het
Ppp2r2a A T 14: 67,038,954 V34E probably damaging Het
Prpf8 T G 11: 75,493,508 S659R possibly damaging Het
Ptprd A G 4: 76,128,995 S342P probably damaging Het
Pum2 T C 12: 8,744,755 probably null Het
Ranbp3 T G 17: 56,677,208 probably null Het
Rassf7 A G 7: 141,217,243 E123G probably damaging Het
Rcor1 G T 12: 111,111,877 A469S probably benign Het
Rcor3 G T 1: 192,100,896 P524Q probably damaging Het
Rnf44 A T 13: 54,682,107 probably null Het
Rtf1 T C 2: 119,675,177 V37A unknown Het
Sdc4 A T 2: 164,431,218 D57E probably damaging Het
Setbp1 T C 18: 78,858,002 T817A probably benign Het
Setd1a A G 7: 127,791,299 E506G unknown Het
Slc30a8 G A 15: 52,335,149 R330Q probably benign Het
Snx22 C A 9: 66,069,641 E14* probably null Het
Spata31d1a A G 13: 59,701,801 S838P possibly damaging Het
Sprr4 G T 3: 92,500,463 Q11K unknown Het
Trpm3 A G 19: 22,910,054 N839S probably benign Het
Vps9d1 T C 8: 123,248,208 probably null Het
Vwa3b T C 1: 37,051,885 probably null Het
Ythdf1 T C 2: 180,911,100 T414A probably damaging Het
Other mutations in Zfp709
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03174:Zfp709 APN 8 71889026 missense probably benign 0.03
IGL03187:Zfp709 APN 8 71889282 missense probably benign 0.41
BB007:Zfp709 UTSW 8 71890840 missense not run
BB017:Zfp709 UTSW 8 71890840 missense not run
R0336:Zfp709 UTSW 8 71890605 missense probably damaging 1.00
R1386:Zfp709 UTSW 8 71890662 missense probably damaging 0.99
R1878:Zfp709 UTSW 8 71890047 missense probably damaging 1.00
R2279:Zfp709 UTSW 8 71889090 missense probably benign 0.31
R2320:Zfp709 UTSW 8 71887292 missense probably damaging 1.00
R2885:Zfp709 UTSW 8 71889705 missense probably benign 0.08
R3833:Zfp709 UTSW 8 71889062 missense probably benign 0.00
R3926:Zfp709 UTSW 8 71890553 missense probably damaging 1.00
R4165:Zfp709 UTSW 8 71890805 nonsense probably null
R4179:Zfp709 UTSW 8 71889906 missense probably damaging 1.00
R4963:Zfp709 UTSW 8 71889788 missense probably benign 0.27
R5340:Zfp709 UTSW 8 71889752 missense probably damaging 1.00
R5427:Zfp709 UTSW 8 71889132 missense probably benign 0.27
R5513:Zfp709 UTSW 8 71890056 missense probably damaging 1.00
R5639:Zfp709 UTSW 8 71889991 unclassified probably null
R5692:Zfp709 UTSW 8 71890155 missense probably damaging 1.00
R5872:Zfp709 UTSW 8 71889519 missense probably benign 0.03
R5940:Zfp709 UTSW 8 71890220 missense possibly damaging 0.85
R6192:Zfp709 UTSW 8 71890708 small deletion probably benign
R6210:Zfp709 UTSW 8 71890708 small deletion probably benign
R6225:Zfp709 UTSW 8 71890708 small deletion probably benign
R6227:Zfp709 UTSW 8 71890708 small deletion probably benign
R6228:Zfp709 UTSW 8 71890708 small deletion probably benign
R6246:Zfp709 UTSW 8 71890708 small deletion probably benign
R6247:Zfp709 UTSW 8 71890708 small deletion probably benign
R6248:Zfp709 UTSW 8 71890708 small deletion probably benign
R6249:Zfp709 UTSW 8 71890708 small deletion probably benign
R6258:Zfp709 UTSW 8 71890708 small deletion probably benign
R6259:Zfp709 UTSW 8 71890708 small deletion probably benign
R6371:Zfp709 UTSW 8 71889485 missense probably damaging 1.00
R6875:Zfp709 UTSW 8 71889007 missense possibly damaging 0.93
R7871:Zfp709 UTSW 8 71889464 missense probably benign 0.02
R7954:Zfp709 UTSW 8 71889464 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCTCTTCTTTGAGTGGTTGTCAAA -3'
(R):5'- CCTTTCCATGTTCTATACTTAGGGAC -3'

Sequencing Primer
(F):5'- GGGAAAGCCTTTACTAATCCCAGTG -3'
(R):5'- ATACTTAGGGACTTCTACTGTGAGTC -3'
Posted On2018-02-28