Incidental Mutation 'R6250:Vps9d1'
ID505917
Institutional Source Beutler Lab
Gene Symbol Vps9d1
Ensembl Gene ENSMUSG00000001062
Gene NameVPS9 domain containing 1
Synonyms
MMRRC Submission 044367-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6250 (G1)
Quality Score187.009
Status Validated
Chromosome8
Chromosomal Location123242356-123254348 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to C at 123248208 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117643] [ENSMUST00000118279] [ENSMUST00000118279] [ENSMUST00000122363] [ENSMUST00000122363] [ENSMUST00000127664] [ENSMUST00000155869]
Predicted Effect probably benign
Transcript: ENSMUST00000117643
SMART Domains Protein: ENSMUSP00000113748
Gene: ENSMUSG00000001062

DomainStartEndE-ValueType
low complexity region 96 108 N/A INTRINSIC
coiled coil region 187 220 N/A INTRINSIC
low complexity region 266 279 N/A INTRINSIC
low complexity region 442 453 N/A INTRINSIC
Pfam:VPS9 528 645 8.5e-27 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000118279
SMART Domains Protein: ENSMUSP00000113634
Gene: ENSMUSG00000001062

DomainStartEndE-ValueType
low complexity region 96 108 N/A INTRINSIC
coiled coil region 187 220 N/A INTRINSIC
low complexity region 266 279 N/A INTRINSIC
low complexity region 442 453 N/A INTRINSIC
Pfam:VPS9 528 645 1.2e-25 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000118279
SMART Domains Protein: ENSMUSP00000113634
Gene: ENSMUSG00000001062

DomainStartEndE-ValueType
low complexity region 96 108 N/A INTRINSIC
coiled coil region 187 220 N/A INTRINSIC
low complexity region 266 279 N/A INTRINSIC
low complexity region 442 453 N/A INTRINSIC
Pfam:VPS9 528 645 1.2e-25 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000122363
SMART Domains Protein: ENSMUSP00000113575
Gene: ENSMUSG00000001062

DomainStartEndE-ValueType
low complexity region 96 108 N/A INTRINSIC
coiled coil region 187 220 N/A INTRINSIC
low complexity region 266 279 N/A INTRINSIC
low complexity region 442 453 N/A INTRINSIC
Pfam:VPS9 528 644 5.6e-27 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000122363
SMART Domains Protein: ENSMUSP00000113575
Gene: ENSMUSG00000001062

DomainStartEndE-ValueType
low complexity region 96 108 N/A INTRINSIC
coiled coil region 187 220 N/A INTRINSIC
low complexity region 266 279 N/A INTRINSIC
low complexity region 442 453 N/A INTRINSIC
Pfam:VPS9 528 644 5.6e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124508
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127978
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129591
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130275
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130965
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137569
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146136
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149490
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155853
Predicted Effect probably benign
Transcript: ENSMUST00000155869
SMART Domains Protein: ENSMUSP00000122184
Gene: ENSMUSG00000001062

DomainStartEndE-ValueType
low complexity region 96 108 N/A INTRINSIC
coiled coil region 187 223 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency 98% (60/61)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik G A 7: 28,150,714 G1195D probably damaging Het
Abhd12 T C 2: 150,839,747 Y241C probably damaging Het
Ak9 T C 10: 41,389,034 V929A possibly damaging Het
Ap3s1 T C 18: 46,754,447 F49S probably damaging Het
Atp9b T C 18: 80,756,521 H801R probably benign Het
B430218F22Rik A G 13: 118,387,408 probably benign Het
BC030867 A G 11: 102,255,062 T55A probably benign Het
Ccnd3 T A 17: 47,597,562 L186* probably null Het
Cnbd1 T A 4: 19,098,255 Q55L probably benign Het
Commd10 A G 18: 46,963,688 E54G probably damaging Het
D6Ertd527e G A 6: 87,111,212 G119D unknown Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Disp2 A T 2: 118,790,766 I660F probably damaging Het
Eef1a2 A G 2: 181,151,060 F211L possibly damaging Het
Epb41 A T 4: 131,989,873 F323L probably damaging Het
Eps8l3 A T 3: 107,890,465 I403F probably benign Het
Ercc5 T A 1: 44,164,049 V282D probably damaging Het
Faim A T 9: 98,992,123 M1L probably benign Het
Fbxo24 A G 5: 137,621,281 F111L probably damaging Het
Glrx A T 13: 75,840,110 I48F probably damaging Het
Gucy2g A T 19: 55,217,424 L668Q probably damaging Het
Hectd4 A G 5: 121,339,498 D2828G possibly damaging Het
Hivep2 T C 10: 14,131,759 V1367A probably benign Het
Ipo13 A G 4: 117,912,154 V147A possibly damaging Het
Jchain T C 5: 88,526,175 T37A probably benign Het
Kif1b A G 4: 149,213,643 V1034A probably benign Het
Krt25 T A 11: 99,321,163 N216I probably damaging Het
Lman1l A G 9: 57,615,624 V151A probably benign Het
Mfsd4b1 T C 10: 40,003,110 S264G possibly damaging Het
Mxra8 G T 4: 155,841,089 R82L possibly damaging Het
Nlrp1b A T 11: 71,181,799 I406N probably benign Het
Olfr1381 A T 11: 49,551,884 I46F probably damaging Het
Olfr155 T C 4: 43,854,363 L18P possibly damaging Het
Olfr191 G A 16: 59,085,832 S217F probably damaging Het
Pak7 T C 2: 136,174,269 probably benign Het
Pcsk4 T C 10: 80,325,592 R222G probably benign Het
Pik3cb A C 9: 99,094,598 F149V probably benign Het
Plscr4 G A 9: 92,484,828 R165Q possibly damaging Het
Ppp2r2a A T 14: 67,038,954 V34E probably damaging Het
Prpf8 T G 11: 75,493,508 S659R possibly damaging Het
Ptprd A G 4: 76,128,995 S342P probably damaging Het
Pum2 T C 12: 8,744,755 probably null Het
Ranbp3 T G 17: 56,677,208 probably null Het
Rassf7 A G 7: 141,217,243 E123G probably damaging Het
Rcor1 G T 12: 111,111,877 A469S probably benign Het
Rcor3 G T 1: 192,100,896 P524Q probably damaging Het
Rnf44 A T 13: 54,682,107 probably null Het
Rtf1 T C 2: 119,675,177 V37A unknown Het
Sdc4 A T 2: 164,431,218 D57E probably damaging Het
Setbp1 T C 18: 78,858,002 T817A probably benign Het
Setd1a A G 7: 127,791,299 E506G unknown Het
Slc30a8 G A 15: 52,335,149 R330Q probably benign Het
Snx22 C A 9: 66,069,641 E14* probably null Het
Spata31d1a A G 13: 59,701,801 S838P possibly damaging Het
Sprr4 G T 3: 92,500,463 Q11K unknown Het
Trpm3 A G 19: 22,910,054 N839S probably benign Het
Vwa3b T C 1: 37,051,885 probably null Het
Ythdf1 T C 2: 180,911,100 T414A probably damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Other mutations in Vps9d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00549:Vps9d1 APN 8 123245198 missense probably damaging 1.00
IGL01112:Vps9d1 APN 8 123246030 missense probably damaging 1.00
IGL01729:Vps9d1 APN 8 123247000 missense probably damaging 1.00
R0568:Vps9d1 UTSW 8 123246748 missense probably damaging 1.00
R1191:Vps9d1 UTSW 8 123247967 missense possibly damaging 0.95
R1813:Vps9d1 UTSW 8 123247039 missense probably damaging 0.99
R1896:Vps9d1 UTSW 8 123247039 missense probably damaging 0.99
R2193:Vps9d1 UTSW 8 123252665 missense probably damaging 1.00
R2256:Vps9d1 UTSW 8 123245121 missense probably benign 0.18
R4305:Vps9d1 UTSW 8 123248237 intron probably benign
R4458:Vps9d1 UTSW 8 123247748 missense probably benign 0.30
R4707:Vps9d1 UTSW 8 123248612 critical splice donor site probably benign
R5366:Vps9d1 UTSW 8 123245114 missense possibly damaging 0.89
R5392:Vps9d1 UTSW 8 123254013 missense probably damaging 0.99
R5423:Vps9d1 UTSW 8 123247965 critical splice donor site probably null
R5645:Vps9d1 UTSW 8 123247748 missense probably benign 0.30
R5647:Vps9d1 UTSW 8 123248859 missense probably damaging 1.00
R5695:Vps9d1 UTSW 8 123246916 missense probably benign
R5908:Vps9d1 UTSW 8 123246824 missense probably benign 0.28
R6061:Vps9d1 UTSW 8 123245671 missense probably damaging 0.99
R6416:Vps9d1 UTSW 8 123248639 missense probably damaging 1.00
R6747:Vps9d1 UTSW 8 123254007 missense probably damaging 1.00
R7049:Vps9d1 UTSW 8 123247143 nonsense probably null
R7584:Vps9d1 UTSW 8 123250717 missense probably damaging 1.00
R8321:Vps9d1 UTSW 8 123248805 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- TGACTGCAGAACCTCCTGAG -3'
(R):5'- CCTCTCTAGCACTAATTAGGTGC -3'

Sequencing Primer
(F):5'- CTCCTGAGGAAGAAGATAGGCTG -3'
(R):5'- AAGTCTGCCTTCCTGAGTAAAGC -3'
Posted On2018-02-28