Mutagenetix > Incidental Mutations

Incidental Mutation 'R6250:Plscr4'

505920

Institutional Source

Beutler Lab

Gene Symbol

Plscr4

Ensembl Gene

ENSMUSG00000032377

Gene Name

phospholipid scramblase 4

Synonyms

MMRRC Submission

044367-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.051) question?

Stock #

R6250 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

92457373-92492456 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 92484828 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 165 (R165Q)

Ref Sequence

ENSEMBL: ENSMUSP00000034941 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034941]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000034941
AA Change: R165Q

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000034941
Gene: ENSMUSG00000032377
AA Change: R165Q

Domain	Start	End	E-Value	Type
low complexity region	38	51	N/A	INTRINSIC
Pfam:Scramblase	96	318	7.5e-87	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143866

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.5%

Validation Efficiency

98% (60/61)

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530053A07Rik	G	A	7: 28,150,714	G1195D	probably damaging	Het
Abhd12	T	C	2: 150,839,747	Y241C	probably damaging	Het
Ak9	T	C	10: 41,389,034	V929A	possibly damaging	Het
Ap3s1	T	C	18: 46,754,447	F49S	probably damaging	Het
Atp9b	T	C	18: 80,756,521	H801R	probably benign	Het
B430218F22Rik	A	G	13: 118,387,408		probably benign	Het
BC030867	A	G	11: 102,255,062	T55A	probably benign	Het
Ccnd3	T	A	17: 47,597,562	L186*	probably null	Het
Cnbd1	T	A	4: 19,098,255	Q55L	probably benign	Het
Commd10	A	G	18: 46,963,688	E54G	probably damaging	Het
D6Ertd527e	G	A	6: 87,111,212	G119D	unknown	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Disp2	A	T	2: 118,790,766	I660F	probably damaging	Het
Eef1a2	A	G	2: 181,151,060	F211L	possibly damaging	Het
Epb41	A	T	4: 131,989,873	F323L	probably damaging	Het
Eps8l3	A	T	3: 107,890,465	I403F	probably benign	Het
Ercc5	T	A	1: 44,164,049	V282D	probably damaging	Het
Faim	A	T	9: 98,992,123	M1L	probably benign	Het
Fbxo24	A	G	5: 137,621,281	F111L	probably damaging	Het
Glrx	A	T	13: 75,840,110	I48F	probably damaging	Het
Gucy2g	A	T	19: 55,217,424	L668Q	probably damaging	Het
Hectd4	A	G	5: 121,339,498	D2828G	possibly damaging	Het
Hivep2	T	C	10: 14,131,759	V1367A	probably benign	Het
Ipo13	A	G	4: 117,912,154	V147A	possibly damaging	Het
Jchain	T	C	5: 88,526,175	T37A	probably benign	Het
Kif1b	A	G	4: 149,213,643	V1034A	probably benign	Het
Krt25	T	A	11: 99,321,163	N216I	probably damaging	Het
Lman1l	A	G	9: 57,615,624	V151A	probably benign	Het
Mfsd4b1	T	C	10: 40,003,110	S264G	possibly damaging	Het
Mxra8	G	T	4: 155,841,089	R82L	possibly damaging	Het
Nlrp1b	A	T	11: 71,181,799	I406N	probably benign	Het
Olfr1381	A	T	11: 49,551,884	I46F	probably damaging	Het
Olfr155	T	C	4: 43,854,363	L18P	possibly damaging	Het
Olfr191	G	A	16: 59,085,832	S217F	probably damaging	Het
Pak7	T	C	2: 136,174,269		probably benign	Het
Pcsk4	T	C	10: 80,325,592	R222G	probably benign	Het
Pik3cb	A	C	9: 99,094,598	F149V	probably benign	Het
Ppp2r2a	A	T	14: 67,038,954	V34E	probably damaging	Het
Prpf8	T	G	11: 75,493,508	S659R	possibly damaging	Het
Ptprd	A	G	4: 76,128,995	S342P	probably damaging	Het
Pum2	T	C	12: 8,744,755		probably null	Het
Ranbp3	T	G	17: 56,677,208		probably null	Het
Rassf7	A	G	7: 141,217,243	E123G	probably damaging	Het
Rcor1	G	T	12: 111,111,877	A469S	probably benign	Het
Rcor3	G	T	1: 192,100,896	P524Q	probably damaging	Het
Rnf44	A	T	13: 54,682,107		probably null	Het
Rtf1	T	C	2: 119,675,177	V37A	unknown	Het
Sdc4	A	T	2: 164,431,218	D57E	probably damaging	Het
Setbp1	T	C	18: 78,858,002	T817A	probably benign	Het
Setd1a	A	G	7: 127,791,299	E506G	unknown	Het
Slc30a8	G	A	15: 52,335,149	R330Q	probably benign	Het
Snx22	C	A	9: 66,069,641	E14*	probably null	Het
Spata31d1a	A	G	13: 59,701,801	S838P	possibly damaging	Het
Sprr4	G	T	3: 92,500,463	Q11K	unknown	Het
Trpm3	A	G	19: 22,910,054	N839S	probably benign	Het
Vps9d1	T	C	8: 123,248,208		probably null	Het
Vwa3b	T	C	1: 37,051,885		probably null	Het
Ythdf1	T	C	2: 180,911,100	T414A	probably damaging	Het
Zfp709	TCGACG	TCG	8: 71,890,708		probably benign	Het

Other mutations in Plscr4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00763:Plscr4	APN	9	92484945	missense	probably null	1.00
IGL02506:Plscr4	APN	9	92489991	missense	possibly damaging	0.67
BB009:Plscr4	UTSW	9	92490790	nonsense	probably null
BB019:Plscr4	UTSW	9	92490790	nonsense	probably null
R0331:Plscr4	UTSW	9	92482642	missense	probably damaging	1.00
R0360:Plscr4	UTSW	9	92488761	splice site	probably benign
R0838:Plscr4	UTSW	9	92471760	splice site	probably benign
R0898:Plscr4	UTSW	9	92484753	missense	probably damaging	0.98
R1845:Plscr4	UTSW	9	92490046	missense	probably damaging	1.00
R1895:Plscr4	UTSW	9	92483836	missense	probably damaging	0.99
R1946:Plscr4	UTSW	9	92483836	missense	probably damaging	0.99
R2127:Plscr4	UTSW	9	92488630	missense	possibly damaging	0.82
R3427:Plscr4	UTSW	9	92488744	missense	probably damaging	0.99
R4670:Plscr4	UTSW	9	92482867	critical splice donor site	probably null
R4764:Plscr4	UTSW	9	92484780	missense	probably damaging	0.99
R4958:Plscr4	UTSW	9	92484761	missense	possibly damaging	0.95
R5126:Plscr4	UTSW	9	92488741	missense	probably damaging	1.00
R5424:Plscr4	UTSW	9	92490022	missense	possibly damaging	0.67
R6476:Plscr4	UTSW	9	92490766	missense	probably benign	0.01
R6775:Plscr4	UTSW	9	92482805	missense	probably benign
R6810:Plscr4	UTSW	9	92483836	missense	probably damaging	0.99
R6982:Plscr4	UTSW	9	92482743	missense	probably benign	0.00
R7127:Plscr4	UTSW	9	92490778	nonsense	probably null
R7190:Plscr4	UTSW	9	92488641	missense	probably benign	0.11
R7741:Plscr4	UTSW	9	92482640	critical splice acceptor site	probably null
R7818:Plscr4	UTSW	9	92490790	nonsense	probably null
R7819:Plscr4	UTSW	9	92490790	nonsense	probably null
R7837:Plscr4	UTSW	9	92484923	missense	probably damaging	1.00
R7932:Plscr4	UTSW	9	92490790	nonsense	probably null
R7938:Plscr4	UTSW	9	92490790	nonsense	probably null
R7940:Plscr4	UTSW	9	92490790	nonsense	probably null
R8004:Plscr4	UTSW	9	92490790	nonsense	probably null
R8005:Plscr4	UTSW	9	92490790	nonsense	probably null
R8008:Plscr4	UTSW	9	92490790	nonsense	probably null
R8346:Plscr4	UTSW	9	92490790	nonsense	probably null
R8348:Plscr4	UTSW	9	92490790	nonsense	probably null
R8423:Plscr4	UTSW	9	92490790	nonsense	probably null
R8426:Plscr4	UTSW	9	92490790	nonsense	probably null
R8427:Plscr4	UTSW	9	92490790	nonsense	probably null
R8507:Plscr4	UTSW	9	92490790	nonsense	probably null
R8509:Plscr4	UTSW	9	92490790	nonsense	probably null
R8510:Plscr4	UTSW	9	92490790	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TCTGAAGCCTGTCTCAGCTG -3'
(R):5'- AGTTTCATTCTGAGCAGTAGGG -3'

Sequencing Primer
(F):5'- GTCTCAGCTGGTTCTAACTTAAGATC -3'
(R):5'- AGACCAACCATTGTGTCAAGG -3'

Posted On

2018-02-28