Incidental Mutation 'R6250:Pik3cb'
ID505922
Institutional Source Beutler Lab
Gene Symbol Pik3cb
Ensembl Gene ENSMUSG00000032462
Gene Namephosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit beta
Synonymsp110beta, 1110001J02Rik
MMRRC Submission 044367-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R6250 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location99036654-99140621 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 99094598 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 149 (F149V)
Ref Sequence ENSEMBL: ENSMUSP00000138346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035037] [ENSMUST00000136965]
Predicted Effect probably benign
Transcript: ENSMUST00000035037
AA Change: F149V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000035037
Gene: ENSMUSG00000032462
AA Change: F149V

DomainStartEndE-ValueType
PI3K_p85B 35 112 2.44e-50 SMART
PI3K_rbd 174 282 1.88e-42 SMART
low complexity region 305 311 N/A INTRINSIC
PI3K_C2 315 417 4.64e-33 SMART
PI3Ka 519 705 1.08e-92 SMART
PI3Kc 795 1061 8.75e-134 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136965
AA Change: F149V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000138346
Gene: ENSMUSG00000032462
AA Change: F149V

DomainStartEndE-ValueType
PI3K_p85B 35 112 2.44e-50 SMART
PI3K_rbd 174 282 1.88e-42 SMART
low complexity region 305 311 N/A INTRINSIC
PI3K_C2 315 417 4.64e-33 SMART
Blast:PI3Ka 450 520 1e-37 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an isoform of the catalytic subunit of phosphoinositide 3-kinase (PI3K). These kinases are important in signaling pathways involving receptors on the outer membrane of eukaryotic cells and are named for their catalytic subunit. The encoded protein is the catalytic subunit for PI3Kbeta (PI3KB). PI3KB has been shown to be part of the activation pathway in neutrophils which have bound immune complexes at sites of injury or infection. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit 30% fetal lethality, decreased size at birth and postnatally, abnormal glucose homeostasis, and dyslipidemia. Mice homozygous for a different knock-out allele die prior to E8.5 [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik G A 7: 28,150,714 G1195D probably damaging Het
Abhd12 T C 2: 150,839,747 Y241C probably damaging Het
Ak9 T C 10: 41,389,034 V929A possibly damaging Het
Ap3s1 T C 18: 46,754,447 F49S probably damaging Het
Atp9b T C 18: 80,756,521 H801R probably benign Het
B430218F22Rik A G 13: 118,387,408 probably benign Het
BC030867 A G 11: 102,255,062 T55A probably benign Het
Ccnd3 T A 17: 47,597,562 L186* probably null Het
Cnbd1 T A 4: 19,098,255 Q55L probably benign Het
Commd10 A G 18: 46,963,688 E54G probably damaging Het
D6Ertd527e G A 6: 87,111,212 G119D unknown Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Disp2 A T 2: 118,790,766 I660F probably damaging Het
Eef1a2 A G 2: 181,151,060 F211L possibly damaging Het
Epb41 A T 4: 131,989,873 F323L probably damaging Het
Eps8l3 A T 3: 107,890,465 I403F probably benign Het
Ercc5 T A 1: 44,164,049 V282D probably damaging Het
Faim A T 9: 98,992,123 M1L probably benign Het
Fbxo24 A G 5: 137,621,281 F111L probably damaging Het
Glrx A T 13: 75,840,110 I48F probably damaging Het
Gucy2g A T 19: 55,217,424 L668Q probably damaging Het
Hectd4 A G 5: 121,339,498 D2828G possibly damaging Het
Hivep2 T C 10: 14,131,759 V1367A probably benign Het
Ipo13 A G 4: 117,912,154 V147A possibly damaging Het
Jchain T C 5: 88,526,175 T37A probably benign Het
Kif1b A G 4: 149,213,643 V1034A probably benign Het
Krt25 T A 11: 99,321,163 N216I probably damaging Het
Lman1l A G 9: 57,615,624 V151A probably benign Het
Mfsd4b1 T C 10: 40,003,110 S264G possibly damaging Het
Mxra8 G T 4: 155,841,089 R82L possibly damaging Het
Nlrp1b A T 11: 71,181,799 I406N probably benign Het
Olfr1381 A T 11: 49,551,884 I46F probably damaging Het
Olfr155 T C 4: 43,854,363 L18P possibly damaging Het
Olfr191 G A 16: 59,085,832 S217F probably damaging Het
Pak7 T C 2: 136,174,269 probably benign Het
Pcsk4 T C 10: 80,325,592 R222G probably benign Het
Plscr4 G A 9: 92,484,828 R165Q possibly damaging Het
Ppp2r2a A T 14: 67,038,954 V34E probably damaging Het
Prpf8 T G 11: 75,493,508 S659R possibly damaging Het
Ptprd A G 4: 76,128,995 S342P probably damaging Het
Pum2 T C 12: 8,744,755 probably null Het
Ranbp3 T G 17: 56,677,208 probably null Het
Rassf7 A G 7: 141,217,243 E123G probably damaging Het
Rcor1 G T 12: 111,111,877 A469S probably benign Het
Rcor3 G T 1: 192,100,896 P524Q probably damaging Het
Rnf44 A T 13: 54,682,107 probably null Het
Rtf1 T C 2: 119,675,177 V37A unknown Het
Sdc4 A T 2: 164,431,218 D57E probably damaging Het
Setbp1 T C 18: 78,858,002 T817A probably benign Het
Setd1a A G 7: 127,791,299 E506G unknown Het
Slc30a8 G A 15: 52,335,149 R330Q probably benign Het
Snx22 C A 9: 66,069,641 E14* probably null Het
Spata31d1a A G 13: 59,701,801 S838P possibly damaging Het
Sprr4 G T 3: 92,500,463 Q11K unknown Het
Trpm3 A G 19: 22,910,054 N839S probably benign Het
Vps9d1 T C 8: 123,248,208 probably null Het
Vwa3b T C 1: 37,051,885 probably null Het
Ythdf1 T C 2: 180,911,100 T414A probably damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Other mutations in Pik3cb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00933:Pik3cb APN 9 99101286 missense probably damaging 0.96
IGL01354:Pik3cb APN 9 99064168 missense possibly damaging 0.83
IGL02132:Pik3cb APN 9 99071377 missense probably benign 0.01
IGL02268:Pik3cb APN 9 99046556 missense probably benign 0.00
IGL02376:Pik3cb APN 9 99052352 missense probably benign 0.00
IGL02378:Pik3cb APN 9 99062840 missense probably benign 0.40
IGL02748:Pik3cb APN 9 99062968 splice site probably benign
IGL03038:Pik3cb APN 9 99065597 missense probably damaging 1.00
IGL03142:Pik3cb APN 9 99065562 missense probably benign 0.10
H8786:Pik3cb UTSW 9 99046559 missense possibly damaging 0.80
R0071:Pik3cb UTSW 9 99044865 missense probably benign 0.02
R0071:Pik3cb UTSW 9 99044865 missense probably benign 0.02
R0305:Pik3cb UTSW 9 99064076 missense possibly damaging 0.86
R0464:Pik3cb UTSW 9 99044743 critical splice donor site probably null
R0635:Pik3cb UTSW 9 99064218 splice site probably benign
R1386:Pik3cb UTSW 9 99064027 missense possibly damaging 0.90
R1530:Pik3cb UTSW 9 99053973 missense probably damaging 0.96
R1802:Pik3cb UTSW 9 99101289 nonsense probably null
R1815:Pik3cb UTSW 9 99093095 missense possibly damaging 0.93
R2011:Pik3cb UTSW 9 99105579 nonsense probably null
R2079:Pik3cb UTSW 9 99060204 missense probably benign 0.27
R2153:Pik3cb UTSW 9 99101244 nonsense probably null
R2237:Pik3cb UTSW 9 99041028 missense probably damaging 1.00
R2238:Pik3cb UTSW 9 99041028 missense probably damaging 1.00
R2513:Pik3cb UTSW 9 99061842 missense probably damaging 1.00
R3982:Pik3cb UTSW 9 99046601 missense probably benign 0.06
R4009:Pik3cb UTSW 9 99040929 missense probably damaging 0.98
R4246:Pik3cb UTSW 9 99101176 splice site probably null
R4248:Pik3cb UTSW 9 99101176 splice site probably null
R4249:Pik3cb UTSW 9 99101176 splice site probably null
R4334:Pik3cb UTSW 9 99061851 missense probably damaging 1.00
R4544:Pik3cb UTSW 9 99039759 missense probably damaging 1.00
R4568:Pik3cb UTSW 9 99090302 missense probably benign 0.00
R4571:Pik3cb UTSW 9 99090257 missense possibly damaging 0.94
R4595:Pik3cb UTSW 9 99055406 missense possibly damaging 0.95
R4599:Pik3cb UTSW 9 99061764 missense probably benign 0.15
R4820:Pik3cb UTSW 9 99073626 missense probably benign 0.00
R4887:Pik3cb UTSW 9 99101328 missense probably damaging 0.99
R4967:Pik3cb UTSW 9 99105632 missense probably benign 0.14
R5029:Pik3cb UTSW 9 99054060 missense probably damaging 0.98
R5031:Pik3cb UTSW 9 99071408 missense probably damaging 1.00
R5394:Pik3cb UTSW 9 99088663 missense probably benign
R5769:Pik3cb UTSW 9 99093159 nonsense probably null
R6128:Pik3cb UTSW 9 99064099 missense possibly damaging 0.95
R6354:Pik3cb UTSW 9 99073643 missense probably benign 0.00
R6370:Pik3cb UTSW 9 99040934 missense probably damaging 1.00
R6664:Pik3cb UTSW 9 99094538 missense possibly damaging 0.56
R6665:Pik3cb UTSW 9 99073649 missense probably benign 0.00
R6751:Pik3cb UTSW 9 99094521 missense probably benign
R6781:Pik3cb UTSW 9 99040992 missense possibly damaging 0.52
R6869:Pik3cb UTSW 9 99060259 missense probably benign 0.08
R6883:Pik3cb UTSW 9 99101400 missense probably benign 0.00
R7150:Pik3cb UTSW 9 99093090 missense probably damaging 1.00
R7446:Pik3cb UTSW 9 99046658 missense probably damaging 1.00
R7679:Pik3cb UTSW 9 99088607 missense probably benign 0.05
R7831:Pik3cb UTSW 9 99088613 missense probably benign
R8300:Pik3cb UTSW 9 99046658 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGTCAGATAAAATCAGAGGCTC -3'
(R):5'- TGCTTGGTAAAAGACAAAACCCAAG -3'

Sequencing Primer
(F):5'- GTCAGATAAAATCAGAGGCTCATTAC -3'
(R):5'- GGTCTTCATGAGTTTGATGC -3'
Posted On2018-02-28