Incidental Mutation 'R6250:Olfr1381'
ID505927
Institutional Source Beutler Lab
Gene Symbol Olfr1381
Ensembl Gene ENSMUSG00000095187
Gene Nameolfactory receptor 1381
SynonymsGA_x6K02T2QP88-5884501-5883566, MOR256-26
MMRRC Submission 044367-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R6250 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location49543449-49556127 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 49551884 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 46 (I46F)
Ref Sequence ENSEMBL: ENSMUSP00000149881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167248] [ENSMUST00000213256] [ENSMUST00000215360]
Predicted Effect probably damaging
Transcript: ENSMUST00000167248
AA Change: I46F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000126003
Gene: ENSMUSG00000095187
AA Change: I46F

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 5.9e-48 PFAM
Pfam:7TM_GPCR_Srsx 35 219 2.4e-5 PFAM
Pfam:7tm_1 41 289 1.2e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213256
AA Change: I46F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000215360
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik G A 7: 28,150,714 G1195D probably damaging Het
Abhd12 T C 2: 150,839,747 Y241C probably damaging Het
Ak9 T C 10: 41,389,034 V929A possibly damaging Het
Ap3s1 T C 18: 46,754,447 F49S probably damaging Het
Atp9b T C 18: 80,756,521 H801R probably benign Het
B430218F22Rik A G 13: 118,387,408 probably benign Het
BC030867 A G 11: 102,255,062 T55A probably benign Het
Ccnd3 T A 17: 47,597,562 L186* probably null Het
Cnbd1 T A 4: 19,098,255 Q55L probably benign Het
Commd10 A G 18: 46,963,688 E54G probably damaging Het
D6Ertd527e G A 6: 87,111,212 G119D unknown Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Disp2 A T 2: 118,790,766 I660F probably damaging Het
Eef1a2 A G 2: 181,151,060 F211L possibly damaging Het
Epb41 A T 4: 131,989,873 F323L probably damaging Het
Eps8l3 A T 3: 107,890,465 I403F probably benign Het
Ercc5 T A 1: 44,164,049 V282D probably damaging Het
Faim A T 9: 98,992,123 M1L probably benign Het
Fbxo24 A G 5: 137,621,281 F111L probably damaging Het
Glrx A T 13: 75,840,110 I48F probably damaging Het
Gucy2g A T 19: 55,217,424 L668Q probably damaging Het
Hectd4 A G 5: 121,339,498 D2828G possibly damaging Het
Hivep2 T C 10: 14,131,759 V1367A probably benign Het
Ipo13 A G 4: 117,912,154 V147A possibly damaging Het
Jchain T C 5: 88,526,175 T37A probably benign Het
Kif1b A G 4: 149,213,643 V1034A probably benign Het
Krt25 T A 11: 99,321,163 N216I probably damaging Het
Lman1l A G 9: 57,615,624 V151A probably benign Het
Mfsd4b1 T C 10: 40,003,110 S264G possibly damaging Het
Mxra8 G T 4: 155,841,089 R82L possibly damaging Het
Nlrp1b A T 11: 71,181,799 I406N probably benign Het
Olfr155 T C 4: 43,854,363 L18P possibly damaging Het
Olfr191 G A 16: 59,085,832 S217F probably damaging Het
Pak7 T C 2: 136,174,269 probably benign Het
Pcsk4 T C 10: 80,325,592 R222G probably benign Het
Pik3cb A C 9: 99,094,598 F149V probably benign Het
Plscr4 G A 9: 92,484,828 R165Q possibly damaging Het
Ppp2r2a A T 14: 67,038,954 V34E probably damaging Het
Prpf8 T G 11: 75,493,508 S659R possibly damaging Het
Ptprd A G 4: 76,128,995 S342P probably damaging Het
Pum2 T C 12: 8,744,755 probably null Het
Ranbp3 T G 17: 56,677,208 probably null Het
Rassf7 A G 7: 141,217,243 E123G probably damaging Het
Rcor1 G T 12: 111,111,877 A469S probably benign Het
Rcor3 G T 1: 192,100,896 P524Q probably damaging Het
Rnf44 A T 13: 54,682,107 probably null Het
Rtf1 T C 2: 119,675,177 V37A unknown Het
Sdc4 A T 2: 164,431,218 D57E probably damaging Het
Setbp1 T C 18: 78,858,002 T817A probably benign Het
Setd1a A G 7: 127,791,299 E506G unknown Het
Slc30a8 G A 15: 52,335,149 R330Q probably benign Het
Snx22 C A 9: 66,069,641 E14* probably null Het
Spata31d1a A G 13: 59,701,801 S838P possibly damaging Het
Sprr4 G T 3: 92,500,463 Q11K unknown Het
Trpm3 A G 19: 22,910,054 N839S probably benign Het
Vps9d1 T C 8: 123,248,208 probably null Het
Vwa3b T C 1: 37,051,885 probably null Het
Ythdf1 T C 2: 180,911,100 T414A probably damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Other mutations in Olfr1381
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:Olfr1381 APN 11 49552137 missense probably damaging 1.00
IGL02166:Olfr1381 APN 11 49551930 missense probably damaging 1.00
IGL02723:Olfr1381 APN 11 49552679 missense probably benign 0.28
R0518:Olfr1381 UTSW 11 49552464 missense probably damaging 1.00
R0521:Olfr1381 UTSW 11 49552464 missense probably damaging 1.00
R2109:Olfr1381 UTSW 11 49552433 missense probably damaging 1.00
R4198:Olfr1381 UTSW 11 49552634 missense possibly damaging 0.61
R6155:Olfr1381 UTSW 11 49552584 missense possibly damaging 0.93
R6181:Olfr1381 UTSW 11 49552293 missense probably damaging 0.97
R6372:Olfr1381 UTSW 11 49551930 missense probably damaging 1.00
R6616:Olfr1381 UTSW 11 49552041 missense probably damaging 0.97
R7391:Olfr1381 UTSW 11 49552544 missense probably damaging 1.00
Z1177:Olfr1381 UTSW 11 49552284 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGATGCTGAGAGGAGCC -3'
(R):5'- TCAGTTCCTCCCAGTGAGAG -3'

Sequencing Primer
(F):5'- GTTCTCCATTAATAGCATTGTTTGTC -3'
(R):5'- AGCACTATGCAGAGCTGGGC -3'
Posted On2018-02-28