Incidental Mutation 'R6250:Rnf44'
ID505932
Institutional Source Beutler Lab
Gene Symbol Rnf44
Ensembl Gene ENSMUSG00000034928
Gene Namering finger protein 44
Synonyms
MMRRC Submission 044367-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6250 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location54679399-54693907 bp(-) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) A to T at 54682107 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037422] [ENSMUST00000122935] [ENSMUST00000125871] [ENSMUST00000125927] [ENSMUST00000126717] [ENSMUST00000128257] [ENSMUST00000129881] [ENSMUST00000134177] [ENSMUST00000134862] [ENSMUST00000145397] [ENSMUST00000146931] [ENSMUST00000150626] [ENSMUST00000150806] [ENSMUST00000177950]
Predicted Effect probably null
Transcript: ENSMUST00000037422
SMART Domains Protein: ENSMUSP00000043974
Gene: ENSMUSG00000034928

DomainStartEndE-ValueType
low complexity region 104 113 N/A INTRINSIC
low complexity region 206 228 N/A INTRINSIC
RING 298 338 3.21e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122935
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123333
Predicted Effect probably null
Transcript: ENSMUST00000125871
SMART Domains Protein: ENSMUSP00000118474
Gene: ENSMUSG00000034928

DomainStartEndE-ValueType
low complexity region 148 155 N/A INTRINSIC
low complexity region 186 195 N/A INTRINSIC
low complexity region 288 310 N/A INTRINSIC
RING 380 420 3.21e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125927
Predicted Effect probably benign
Transcript: ENSMUST00000126717
SMART Domains Protein: ENSMUSP00000116043
Gene: ENSMUSG00000034928

DomainStartEndE-ValueType
low complexity region 185 194 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128038
Predicted Effect probably null
Transcript: ENSMUST00000128257
SMART Domains Protein: ENSMUSP00000116850
Gene: ENSMUSG00000034928

DomainStartEndE-ValueType
low complexity region 104 113 N/A INTRINSIC
low complexity region 206 228 N/A INTRINSIC
RING 298 338 3.21e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129881
Predicted Effect probably benign
Transcript: ENSMUST00000134177
Predicted Effect probably null
Transcript: ENSMUST00000134862
SMART Domains Protein: ENSMUSP00000114259
Gene: ENSMUSG00000034928

DomainStartEndE-ValueType
low complexity region 67 74 N/A INTRINSIC
low complexity region 105 114 N/A INTRINSIC
low complexity region 207 229 N/A INTRINSIC
RING 299 339 1.5e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144052
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145215
Predicted Effect probably benign
Transcript: ENSMUST00000145397
Predicted Effect probably benign
Transcript: ENSMUST00000146931
Predicted Effect probably benign
Transcript: ENSMUST00000150626
Predicted Effect probably null
Transcript: ENSMUST00000150806
SMART Domains Protein: ENSMUSP00000123198
Gene: ENSMUSG00000034928

DomainStartEndE-ValueType
low complexity region 67 74 N/A INTRINSIC
low complexity region 105 114 N/A INTRINSIC
low complexity region 207 229 N/A INTRINSIC
RING 299 339 1.5e-10 SMART
Predicted Effect probably null
Transcript: ENSMUST00000177950
SMART Domains Protein: ENSMUSP00000136732
Gene: ENSMUSG00000034928

DomainStartEndE-ValueType
low complexity region 104 113 N/A INTRINSIC
low complexity region 206 228 N/A INTRINSIC
RING 298 338 3.21e-8 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RING finger, a motif present in a variety of functionally distinct proteins and known to be involved in protein-protein and protein-DNA interactions. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik G A 7: 28,150,714 G1195D probably damaging Het
Abhd12 T C 2: 150,839,747 Y241C probably damaging Het
Ak9 T C 10: 41,389,034 V929A possibly damaging Het
Ap3s1 T C 18: 46,754,447 F49S probably damaging Het
Atp9b T C 18: 80,756,521 H801R probably benign Het
B430218F22Rik A G 13: 118,387,408 probably benign Het
BC030867 A G 11: 102,255,062 T55A probably benign Het
Ccnd3 T A 17: 47,597,562 L186* probably null Het
Cnbd1 T A 4: 19,098,255 Q55L probably benign Het
Commd10 A G 18: 46,963,688 E54G probably damaging Het
D6Ertd527e G A 6: 87,111,212 G119D unknown Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Disp2 A T 2: 118,790,766 I660F probably damaging Het
Eef1a2 A G 2: 181,151,060 F211L possibly damaging Het
Epb41 A T 4: 131,989,873 F323L probably damaging Het
Eps8l3 A T 3: 107,890,465 I403F probably benign Het
Ercc5 T A 1: 44,164,049 V282D probably damaging Het
Faim A T 9: 98,992,123 M1L probably benign Het
Fbxo24 A G 5: 137,621,281 F111L probably damaging Het
Glrx A T 13: 75,840,110 I48F probably damaging Het
Gucy2g A T 19: 55,217,424 L668Q probably damaging Het
Hectd4 A G 5: 121,339,498 D2828G possibly damaging Het
Hivep2 T C 10: 14,131,759 V1367A probably benign Het
Ipo13 A G 4: 117,912,154 V147A possibly damaging Het
Jchain T C 5: 88,526,175 T37A probably benign Het
Kif1b A G 4: 149,213,643 V1034A probably benign Het
Krt25 T A 11: 99,321,163 N216I probably damaging Het
Lman1l A G 9: 57,615,624 V151A probably benign Het
Mfsd4b1 T C 10: 40,003,110 S264G possibly damaging Het
Mxra8 G T 4: 155,841,089 R82L possibly damaging Het
Nlrp1b A T 11: 71,181,799 I406N probably benign Het
Olfr1381 A T 11: 49,551,884 I46F probably damaging Het
Olfr155 T C 4: 43,854,363 L18P possibly damaging Het
Olfr191 G A 16: 59,085,832 S217F probably damaging Het
Pak7 T C 2: 136,174,269 probably benign Het
Pcsk4 T C 10: 80,325,592 R222G probably benign Het
Pik3cb A C 9: 99,094,598 F149V probably benign Het
Plscr4 G A 9: 92,484,828 R165Q possibly damaging Het
Ppp2r2a A T 14: 67,038,954 V34E probably damaging Het
Prpf8 T G 11: 75,493,508 S659R possibly damaging Het
Ptprd A G 4: 76,128,995 S342P probably damaging Het
Pum2 T C 12: 8,744,755 probably null Het
Ranbp3 T G 17: 56,677,208 probably null Het
Rassf7 A G 7: 141,217,243 E123G probably damaging Het
Rcor1 G T 12: 111,111,877 A469S probably benign Het
Rcor3 G T 1: 192,100,896 P524Q probably damaging Het
Rtf1 T C 2: 119,675,177 V37A unknown Het
Sdc4 A T 2: 164,431,218 D57E probably damaging Het
Setbp1 T C 18: 78,858,002 T817A probably benign Het
Setd1a A G 7: 127,791,299 E506G unknown Het
Slc30a8 G A 15: 52,335,149 R330Q probably benign Het
Snx22 C A 9: 66,069,641 E14* probably null Het
Spata31d1a A G 13: 59,701,801 S838P possibly damaging Het
Sprr4 G T 3: 92,500,463 Q11K unknown Het
Trpm3 A G 19: 22,910,054 N839S probably benign Het
Vps9d1 T C 8: 123,248,208 probably null Het
Vwa3b T C 1: 37,051,885 probably null Het
Ythdf1 T C 2: 180,911,100 T414A probably damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Other mutations in Rnf44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01837:Rnf44 APN 13 54682153 missense probably damaging 1.00
IGL01934:Rnf44 APN 13 54681950 missense probably damaging 0.98
IGL02629:Rnf44 APN 13 54683062 missense possibly damaging 0.89
IGL03030:Rnf44 APN 13 54681990 nonsense probably null
R1403:Rnf44 UTSW 13 54682008 missense probably damaging 0.99
R1403:Rnf44 UTSW 13 54682008 missense probably damaging 0.99
R1654:Rnf44 UTSW 13 54681779 missense possibly damaging 0.82
R1745:Rnf44 UTSW 13 54682192 missense probably damaging 1.00
R3983:Rnf44 UTSW 13 54683148 missense probably damaging 1.00
R4086:Rnf44 UTSW 13 54682335 missense possibly damaging 0.77
R4893:Rnf44 UTSW 13 54681932 critical splice donor site probably null
R5907:Rnf44 UTSW 13 54682808 missense possibly damaging 0.50
R5997:Rnf44 UTSW 13 54682800 missense possibly damaging 0.50
R6519:Rnf44 UTSW 13 54681786 missense probably damaging 1.00
R7694:Rnf44 UTSW 13 54682028 missense probably damaging 1.00
X0012:Rnf44 UTSW 13 54682847 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTCAACCACTTGTCAACACACTTG -3'
(R):5'- GAACTATGAGGTCTGTGGAGCC -3'

Sequencing Primer
(F):5'- TGTCAACACACTTGGCATGG -3'
(R):5'- CTGGGCCAGGAAGGGGTG -3'
Posted On2018-02-28