Incidental Mutation 'R6250:Spata31d1a'
ID505933
Institutional Source Beutler Lab
Gene Symbol Spata31d1a
Ensembl Gene ENSMUSG00000050876
Gene Namespermatogenesis associated 31 subfamily D, member 1A
Synonyms
MMRRC Submission 044367-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R6250 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location59699806-59710330 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59701801 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 838 (S838P)
Ref Sequence ENSEMBL: ENSMUSP00000152919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066510] [ENSMUST00000224469] [ENSMUST00000224982]
Predicted Effect possibly damaging
Transcript: ENSMUST00000066510
AA Change: S838P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128533
Gene: ENSMUSG00000050876
AA Change: S838P

DomainStartEndE-ValueType
transmembrane domain 31 53 N/A INTRINSIC
Pfam:DUF4599 66 150 3.7e-25 PFAM
low complexity region 196 217 N/A INTRINSIC
low complexity region 240 266 N/A INTRINSIC
Pfam:FAM75 400 772 2.9e-108 PFAM
low complexity region 1144 1154 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224469
Predicted Effect possibly damaging
Transcript: ENSMUST00000224982
AA Change: S838P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225362
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency 98% (60/61)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik G A 7: 28,150,714 G1195D probably damaging Het
Abhd12 T C 2: 150,839,747 Y241C probably damaging Het
Ak9 T C 10: 41,389,034 V929A possibly damaging Het
Ap3s1 T C 18: 46,754,447 F49S probably damaging Het
Atp9b T C 18: 80,756,521 H801R probably benign Het
B430218F22Rik A G 13: 118,387,408 probably benign Het
BC030867 A G 11: 102,255,062 T55A probably benign Het
Ccnd3 T A 17: 47,597,562 L186* probably null Het
Cnbd1 T A 4: 19,098,255 Q55L probably benign Het
Commd10 A G 18: 46,963,688 E54G probably damaging Het
D6Ertd527e G A 6: 87,111,212 G119D unknown Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Disp2 A T 2: 118,790,766 I660F probably damaging Het
Eef1a2 A G 2: 181,151,060 F211L possibly damaging Het
Epb41 A T 4: 131,989,873 F323L probably damaging Het
Eps8l3 A T 3: 107,890,465 I403F probably benign Het
Ercc5 T A 1: 44,164,049 V282D probably damaging Het
Faim A T 9: 98,992,123 M1L probably benign Het
Fbxo24 A G 5: 137,621,281 F111L probably damaging Het
Glrx A T 13: 75,840,110 I48F probably damaging Het
Gucy2g A T 19: 55,217,424 L668Q probably damaging Het
Hectd4 A G 5: 121,339,498 D2828G possibly damaging Het
Hivep2 T C 10: 14,131,759 V1367A probably benign Het
Ipo13 A G 4: 117,912,154 V147A possibly damaging Het
Jchain T C 5: 88,526,175 T37A probably benign Het
Kif1b A G 4: 149,213,643 V1034A probably benign Het
Krt25 T A 11: 99,321,163 N216I probably damaging Het
Lman1l A G 9: 57,615,624 V151A probably benign Het
Mfsd4b1 T C 10: 40,003,110 S264G possibly damaging Het
Mxra8 G T 4: 155,841,089 R82L possibly damaging Het
Nlrp1b A T 11: 71,181,799 I406N probably benign Het
Olfr1381 A T 11: 49,551,884 I46F probably damaging Het
Olfr155 T C 4: 43,854,363 L18P possibly damaging Het
Olfr191 G A 16: 59,085,832 S217F probably damaging Het
Pak7 T C 2: 136,174,269 probably benign Het
Pcsk4 T C 10: 80,325,592 R222G probably benign Het
Pik3cb A C 9: 99,094,598 F149V probably benign Het
Plscr4 G A 9: 92,484,828 R165Q possibly damaging Het
Ppp2r2a A T 14: 67,038,954 V34E probably damaging Het
Prpf8 T G 11: 75,493,508 S659R possibly damaging Het
Ptprd A G 4: 76,128,995 S342P probably damaging Het
Pum2 T C 12: 8,744,755 probably null Het
Ranbp3 T G 17: 56,677,208 probably null Het
Rassf7 A G 7: 141,217,243 E123G probably damaging Het
Rcor1 G T 12: 111,111,877 A469S probably benign Het
Rcor3 G T 1: 192,100,896 P524Q probably damaging Het
Rnf44 A T 13: 54,682,107 probably null Het
Rtf1 T C 2: 119,675,177 V37A unknown Het
Sdc4 A T 2: 164,431,218 D57E probably damaging Het
Setbp1 T C 18: 78,858,002 T817A probably benign Het
Setd1a A G 7: 127,791,299 E506G unknown Het
Slc30a8 G A 15: 52,335,149 R330Q probably benign Het
Snx22 C A 9: 66,069,641 E14* probably null Het
Sprr4 G T 3: 92,500,463 Q11K unknown Het
Trpm3 A G 19: 22,910,054 N839S probably benign Het
Vps9d1 T C 8: 123,248,208 probably null Het
Vwa3b T C 1: 37,051,885 probably null Het
Ythdf1 T C 2: 180,911,100 T414A probably damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Other mutations in Spata31d1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Spata31d1a APN 13 59702185 missense probably benign 0.27
IGL01397:Spata31d1a APN 13 59701738 missense probably damaging 0.99
IGL01448:Spata31d1a APN 13 59701559 missense probably benign 0.06
IGL02715:Spata31d1a APN 13 59703735 missense probably benign 0.44
IGL02983:Spata31d1a APN 13 59703694 missense possibly damaging 0.65
IGL03224:Spata31d1a APN 13 59701026 missense possibly damaging 0.85
PIT1430001:Spata31d1a UTSW 13 59701196 missense probably benign
R0302:Spata31d1a UTSW 13 59703150 missense probably benign
R0387:Spata31d1a UTSW 13 59703501 missense probably damaging 0.99
R0464:Spata31d1a UTSW 13 59701759 missense possibly damaging 0.85
R0606:Spata31d1a UTSW 13 59702431 missense probably benign 0.03
R0617:Spata31d1a UTSW 13 59702259 missense possibly damaging 0.53
R0691:Spata31d1a UTSW 13 59700385 missense possibly damaging 0.93
R0746:Spata31d1a UTSW 13 59702263 missense possibly damaging 0.95
R1019:Spata31d1a UTSW 13 59702368 missense probably benign
R1397:Spata31d1a UTSW 13 59705039 splice site probably benign
R1543:Spata31d1a UTSW 13 59702242 missense probably benign
R1619:Spata31d1a UTSW 13 59702433 nonsense probably null
R1799:Spata31d1a UTSW 13 59703402 missense probably benign
R1820:Spata31d1a UTSW 13 59701255 missense possibly damaging 0.86
R1885:Spata31d1a UTSW 13 59702007 missense probably damaging 0.99
R1909:Spata31d1a UTSW 13 59702695 missense probably damaging 0.99
R2012:Spata31d1a UTSW 13 59702556 missense possibly damaging 0.93
R2099:Spata31d1a UTSW 13 59706071 missense probably damaging 0.97
R2132:Spata31d1a UTSW 13 59701043 missense probably damaging 0.96
R2224:Spata31d1a UTSW 13 59703715 missense probably benign
R2225:Spata31d1a UTSW 13 59703715 missense probably benign
R2226:Spata31d1a UTSW 13 59703715 missense probably benign
R2358:Spata31d1a UTSW 13 59703888 missense probably benign 0.00
R2495:Spata31d1a UTSW 13 59701993 missense possibly damaging 0.93
R3081:Spata31d1a UTSW 13 59703093 missense probably benign 0.15
R3151:Spata31d1a UTSW 13 59701366 missense probably benign 0.06
R3971:Spata31d1a UTSW 13 59702157 missense possibly damaging 0.85
R4156:Spata31d1a UTSW 13 59705047 missense possibly damaging 0.92
R4760:Spata31d1a UTSW 13 59701645 missense probably damaging 1.00
R4767:Spata31d1a UTSW 13 59701155 missense probably benign 0.03
R4877:Spata31d1a UTSW 13 59702523 missense probably damaging 0.99
R4894:Spata31d1a UTSW 13 59701728 missense probably damaging 0.98
R4961:Spata31d1a UTSW 13 59701902 missense possibly damaging 0.86
R4990:Spata31d1a UTSW 13 59703151 missense probably benign 0.00
R4991:Spata31d1a UTSW 13 59703151 missense probably benign 0.00
R4992:Spata31d1a UTSW 13 59703151 missense probably benign 0.00
R5088:Spata31d1a UTSW 13 59701152 unclassified probably null
R5094:Spata31d1a UTSW 13 59705044 critical splice donor site probably null
R5330:Spata31d1a UTSW 13 59700403 missense possibly damaging 0.86
R5587:Spata31d1a UTSW 13 59702618 missense probably damaging 0.96
R5832:Spata31d1a UTSW 13 59701566 missense probably damaging 0.98
R6073:Spata31d1a UTSW 13 59702994 missense probably damaging 0.98
R6208:Spata31d1a UTSW 13 59700564 missense probably damaging 0.98
R6224:Spata31d1a UTSW 13 59706320 start gained probably benign
R6359:Spata31d1a UTSW 13 59703106 missense probably benign
R6806:Spata31d1a UTSW 13 59703218 missense probably benign
R6848:Spata31d1a UTSW 13 59701963 missense possibly damaging 0.91
R6851:Spata31d1a UTSW 13 59703911 missense unknown
R6985:Spata31d1a UTSW 13 59703093 missense probably benign 0.15
R7007:Spata31d1a UTSW 13 59703634 missense probably benign
R7037:Spata31d1a UTSW 13 59700324 missense possibly damaging 0.96
R7124:Spata31d1a UTSW 13 59702487 missense probably damaging 0.99
R7271:Spata31d1a UTSW 13 59702099 missense probably benign 0.00
R7346:Spata31d1a UTSW 13 59703201 missense probably benign
R7556:Spata31d1a UTSW 13 59701984 missense probably benign 0.00
R7581:Spata31d1a UTSW 13 59704139 critical splice donor site probably null
R7891:Spata31d1a UTSW 13 59700325 missense possibly damaging 0.96
R7995:Spata31d1a UTSW 13 59701110 missense probably benign 0.06
Z1177:Spata31d1a UTSW 13 59703085 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTGTTCTCAGAGGCTGGC -3'
(R):5'- TTCTCGGAACATGACACAGCC -3'

Sequencing Primer
(F):5'- CACCAGTGAGGCAGCAG -3'
(R):5'- AGCCTCCACCTGAGACCTG -3'
Posted On2018-02-28