Incidental Mutation 'R6250:Glrx'
ID505934
Institutional Source Beutler Lab
Gene Symbol Glrx
Ensembl Gene ENSMUSG00000021591
Gene Nameglutaredoxin
SynonymsTTase, Grx1, D13Wsu156e
MMRRC Submission 044367-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R6250 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location75839868-75850154 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 75840110 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 48 (I48F)
Ref Sequence ENSEMBL: ENSMUSP00000152829 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022082] [ENSMUST00000220523] [ENSMUST00000223120]
Predicted Effect probably damaging
Transcript: ENSMUST00000022082
AA Change: I48F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022082
Gene: ENSMUSG00000021591
AA Change: I48F

DomainStartEndE-ValueType
Pfam:DUF836 14 91 1.3e-7 PFAM
Pfam:Glutaredoxin 15 80 3.8e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000220523
AA Change: I48F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222530
Predicted Effect probably damaging
Transcript: ENSMUST00000223120
AA Change: I48F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glutaredoxin family. The encoded protein is a cytoplasmic enzyme catalyzing the reversible reduction of glutathione-protein mixed disulfides. This enzyme highly contributes to the antioxidant defense system. It is crucial for several signalling pathways by controlling the S-glutathionylation status of signalling mediators. It is involved in beta-amyloid toxicity and Alzheimer's disease. Multiple alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a null allele do not exhibit any increased injury in response to oxidative insults to the heart or lungs but mouse embryonic fibroblast derived from these embryos are more sensative to diquat and paraqut and more resistant to apoptosis induced by TNF-alpha plus actinomyosin D. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik G A 7: 28,150,714 G1195D probably damaging Het
Abhd12 T C 2: 150,839,747 Y241C probably damaging Het
Ak9 T C 10: 41,389,034 V929A possibly damaging Het
Ap3s1 T C 18: 46,754,447 F49S probably damaging Het
Atp9b T C 18: 80,756,521 H801R probably benign Het
B430218F22Rik A G 13: 118,387,408 probably benign Het
BC030867 A G 11: 102,255,062 T55A probably benign Het
Ccnd3 T A 17: 47,597,562 L186* probably null Het
Cnbd1 T A 4: 19,098,255 Q55L probably benign Het
Commd10 A G 18: 46,963,688 E54G probably damaging Het
D6Ertd527e G A 6: 87,111,212 G119D unknown Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Disp2 A T 2: 118,790,766 I660F probably damaging Het
Eef1a2 A G 2: 181,151,060 F211L possibly damaging Het
Epb41 A T 4: 131,989,873 F323L probably damaging Het
Eps8l3 A T 3: 107,890,465 I403F probably benign Het
Ercc5 T A 1: 44,164,049 V282D probably damaging Het
Faim A T 9: 98,992,123 M1L probably benign Het
Fbxo24 A G 5: 137,621,281 F111L probably damaging Het
Gucy2g A T 19: 55,217,424 L668Q probably damaging Het
Hectd4 A G 5: 121,339,498 D2828G possibly damaging Het
Hivep2 T C 10: 14,131,759 V1367A probably benign Het
Ipo13 A G 4: 117,912,154 V147A possibly damaging Het
Jchain T C 5: 88,526,175 T37A probably benign Het
Kif1b A G 4: 149,213,643 V1034A probably benign Het
Krt25 T A 11: 99,321,163 N216I probably damaging Het
Lman1l A G 9: 57,615,624 V151A probably benign Het
Mfsd4b1 T C 10: 40,003,110 S264G possibly damaging Het
Mxra8 G T 4: 155,841,089 R82L possibly damaging Het
Nlrp1b A T 11: 71,181,799 I406N probably benign Het
Olfr1381 A T 11: 49,551,884 I46F probably damaging Het
Olfr155 T C 4: 43,854,363 L18P possibly damaging Het
Olfr191 G A 16: 59,085,832 S217F probably damaging Het
Pak7 T C 2: 136,174,269 probably benign Het
Pcsk4 T C 10: 80,325,592 R222G probably benign Het
Pik3cb A C 9: 99,094,598 F149V probably benign Het
Plscr4 G A 9: 92,484,828 R165Q possibly damaging Het
Ppp2r2a A T 14: 67,038,954 V34E probably damaging Het
Prpf8 T G 11: 75,493,508 S659R possibly damaging Het
Ptprd A G 4: 76,128,995 S342P probably damaging Het
Pum2 T C 12: 8,744,755 probably null Het
Ranbp3 T G 17: 56,677,208 probably null Het
Rassf7 A G 7: 141,217,243 E123G probably damaging Het
Rcor1 G T 12: 111,111,877 A469S probably benign Het
Rcor3 G T 1: 192,100,896 P524Q probably damaging Het
Rnf44 A T 13: 54,682,107 probably null Het
Rtf1 T C 2: 119,675,177 V37A unknown Het
Sdc4 A T 2: 164,431,218 D57E probably damaging Het
Setbp1 T C 18: 78,858,002 T817A probably benign Het
Setd1a A G 7: 127,791,299 E506G unknown Het
Slc30a8 G A 15: 52,335,149 R330Q probably benign Het
Snx22 C A 9: 66,069,641 E14* probably null Het
Spata31d1a A G 13: 59,701,801 S838P possibly damaging Het
Sprr4 G T 3: 92,500,463 Q11K unknown Het
Trpm3 A G 19: 22,910,054 N839S probably benign Het
Vps9d1 T C 8: 123,248,208 probably null Het
Vwa3b T C 1: 37,051,885 probably null Het
Ythdf1 T C 2: 180,911,100 T414A probably damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Other mutations in Glrx
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1940:Glrx UTSW 13 75840137 missense probably benign 0.26
R2698:Glrx UTSW 13 75839946 utr 5 prime probably null
R5584:Glrx UTSW 13 75847222 missense probably benign 0.17
R6478:Glrx UTSW 13 75847299 critical splice donor site probably null
R8221:Glrx UTSW 13 75847227 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- GCATTACCGGACCATTACTTTC -3'
(R):5'- AGTCCTCTGGCTGCTTTGAAG -3'

Sequencing Primer
(F):5'- GGACCATTACTTTCAACTGCACG -3'
(R):5'- GCTTTGAAGGACAGAGCCC -3'
Posted On2018-02-28